ABCB1 p.Arg543Ser
| Predicted by SNAP2: | A: D (91%), C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (91%), H: D (91%), I: D (95%), K: D (91%), L: D (95%), M: D (91%), N: D (91%), P: D (95%), Q: D (91%), S: D (91%), T: D (91%), V: D (95%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]
Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1.
X
ABCB1 p.Arg543Ser 9169612:20:82
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Arg543Ser 9169612:38:432
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Arg543Ser 9169612:64:174
status: NEWX
ABCB1 p.Arg543Ser 9169612:64:245
status: NEW74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown).
X
ABCB1 p.Arg543Ser 9169612:74:74
status: NEW84 For the MDR1 variants K536I, K536R, I541T and R543S, all four drugs concentration-dependently induced ATPase activities that were not significantly different from those seen in the wild-type MDR1 (Figure 4).
X
ABCB1 p.Arg543Ser 9169612:84:46
status: NEW94 We found similar KATP m values for the ABC-signature mutants showing normal drug-stimulated ATPase activity (K536I, K536R, I541T and R543S; results not shown).
X
ABCB1 p.Arg543Ser 9169612:94:133
status: NEW151 However, our present experiments indicate that the replacement of arginine with serine at this position (R543S) does not induce a major decrease in MDR1 expression or in MDR1 ATPase activity.
X
ABCB1 p.Arg543Ser 9169612:151:105
status: NEW[hide] The power of the pump: mechanisms of action of P-g... Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13. Ambudkar SV, Kim IW, Sauna ZE
The power of the pump: mechanisms of action of P-glycoprotein (ABCB1).
Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13., [PMID:16352426]
Abstract [show]
Members of the superfamily of ATP-binding cassette (ABC) transporters mediate the movement of a variety of substrates including simple ions, complex lipids and xenobiotics. At least 18 ABC transport proteins are associated with disease conditions. P-glycoprotein (Pgp, ABCB1) is the archetypical mammalian ABC transport protein and its mechanism of action has received considerable attention. There is strong biochemical evidence that Pgp moves molecular cargo against a concentration gradient using the energy of ATP hydrolysis. However, the molecular details of how the energy of ATP hydrolysis is coupled to transport remain in dispute and it has not been possible to reconcile the data from various laboratories into a single model. The functional unit of Pgp consists of two nucleotide binding domains (NBDs) and two trans-membrane domains which are involved in the transport of drug substrates. Considerable progress has been made in recent years in characterizing these functionally and spatially distinct domains of Pgp. In addition, our understanding of the domains has been augmented by the resolution of structures of several non-mammalian ABC proteins. This review considers: (i) the role of specific conserved amino acids in ATP hydrolysis mediated by Pgp; (ii) emerging insights into the dimensions of the drug binding pocket and the interactions between Pgp and the transport substrates and (iii) our current understanding of the mechanisms of coupling between energy derived from ATP binding and/or hydrolysis and efflux of drug substrates.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily.
X
ABCB1 p.Arg543Ser 16352426:53:162
status: NEW