ABCMdb

ABCC7 p.Ala559Thr

Admin's notes:	Class II (maturation defect) Veit et al.
ClinVar:	c.1676C>T , p.Ala559Val ? , not provided c.1675G>A , p.Ala559Thr D , Pathogenic c.1676C>A , p.Ala559Glu ? , not provided
CF databases:	c.1675G>A , p.Ala559Thr D , CF-causing ; CFTR1: This mutation has been observed on only one Black CF chromosome. We have not found this mutation on 27 normal Black chromosomes which have at least a 2 site haplotype in common with the haplotype associated with this mutation. c.1676C>A , p.Ala559Glu (CFTR1) D , This substitution involves a residue conserved among species and affects the charge of the CFTR protein. It was found in a CF patient carrying [delta]508 on the other chromosome, and presenting with a severe classical form. c.1676C>T , p.Ala559Val (CFTR1) D , The mutation was identified in homozygosity in a 1-year-old Senegalese CF boy. Both parents were found heterozygotes. The mutation affects a signature motif for the ABC proteins. No other CFTR mutation was found after extensive screening of the coding regions and screening for large rearrangements.
Predicted by SNAP2:	C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: N (82%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Of the 20 mutations that account for the overall detection rate in African Americans when ⌬F508 is excluded, nine that account for 23.6% of the chromosomes analyzed are considered to be "African" mutations6 (444delA, G330X, G480C, R553X, A559T, 2307insA, 3120 ϩ 1GϾA, 3791delC, and S1255X). Login to comment

[hide] The relationship between genotype and exercise tol... Am J Respir Crit Care Med. 2002 Mar 15;165(6):762-5. Selvadurai HC, McKay KO, Blimkie CJ, Cooper PJ, Mellis CM, Van Asperen PP
The relationship between genotype and exercise tolerance in children with cystic fibrosis.
Am J Respir Crit Care Med. 2002 Mar 15;165(6):762-5., 2002-03-15 [PMID:11897641]

Abstract [show]
The relationship between fitness and genotype in children with cystic fibrosis (CF) and at least one copy of the DeltaF508 mutation was examined. Genotype was classified according to the second CF mutation. Fitness was measured by peak aerobic capacity (using a modified Bruce protocol during treadmill exercise) and anaerobic power (using the Wingate test on a cycle ergometer). The class of cystic fibrosis transmembrane regulator proteins (CFTR) mutation was statistically related with aerobic capacity, peak anaerobic power, body mass index, lung function (forced expiratory volume in one second), and disease severity as measured by the Shwachman score. Patients with mutations causing defective CFTR production (Class I) or processing (Class II) had a significantly lower peak aerobic capacity (28.6 +/- 4.2 ml/kg/min and 31.7 +/- 5.4 ml/kg/min, respectively) than those with a mutation conferring defective regulation of CFTR (Class III) (43.9 +/- 6.4 ml/kg/min). The peak anaerobic power in subjects with mutations inducing decreased CFTR conduction (Class IV) or CFTR mRNA (Class V), were significantly higher (11.4 +/- 1.7 and 11.6 +/- 1.5 watts/kg, respectively) than children with Class I (9.7 +/- 1.4 watts/kg), Class II (9.8 +/- 1.4 watts/kg), or Class III (10.5 +/- 1.8 watts/kg) mutations. There were no statistically significant differences in the lung function of patients with the different mutations. These results indicate a relationship between CF genotype and some measures of fitness, the mechanisms of which remain to be determined.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 II ⌬F508 (36), W1282X (1) III G551D (10), N1303K (4), R560T (2), A559T (1) IV R117H (14), R347H (3) V 3849 ϩ 10KbC→T (7), 3120G→A (3) AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 165 2002 All patients were recruited from a single center, and the sample size of this study was large compared with previously published studies of exercise capacity in children with CF (21). Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

[hide] Development and evaluation of a PCR-based, line pr... Clin Chem. 2002 Jul;48(7):1121-3. Wang X, Myers A, Saiki RK, Cutting GR
Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Clin Chem. 2002 Jul;48(7):1121-3., [PMID:12089190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Amplicon Size, bp Mutations (polymorphisms) Exon 13 598 2307 insA Intron 8, exon 09 548 A455E, 5T (7/9 T polymorphism) Exon 10 482 G480C, ⌬I507, ⌬F508 (F508C, I507V, I506V polymorphisms) Intron 10, exon 11 433 1717-1G3A, G542X, G551D, R553X, A559T, R560T Exon 19 420 R1162X, 3659delC Exon 21 397 N1303K Exon 20 359 S1255X, W1282X Exon 07 328 1078delT, R334W, R347P Exon 04, intron 4 288 R117H, 621ϩ1G3T Intron 14b 248 2789ϩ5G3A Intron 19 237 3849ϩ10kbC3T Exon 03 210 G85E, 405ϩ3A3C Intron 5 166 711ϩ1G3T Intron 16 139 3120ϩ1G3A Clinical Chemistry 48, No. Login to comment
88 The genotypes of each sample are as follows: lane 1, ϩ/ϩ (ϩ is the wild type); lane 2, 5T, R117H/3659delC; lane 3, G542X/ϩ; lane 4, I506V/ϩ; lane 5, I507V/ϩ; lane 6, F508C/⌬F508; lane 7, G85E/⌬F508; lane 8, 405ϩ3A3C/3120ϩ1G3C; lane 9, R117H/ϩ; lane 10, 621ϩ1G3T/⌬F508; lane 11, 711ϩ1G3T/⌬F508; lane 12, 1078delT/ϩ; lane 13, R334W/⌬F508; lane 14, R347P/⌬F508; lane 15, A455E/ϩ; lane 16, G480C/⌬F508; lane 17, ⌬I507/ϩ; lane 18, ⌬F508/ϩ; lane 19, 1717-1G3A/ϩ; lane 20, G542X/ϩ; lane 21, G551D/⌬F508; lane 22, R553X/ϩ; lane 23, R560T/⌬F508; lane 24, G551D/A559T; lane 25, 2307insA/ϩ; lane 26, 2789ϩ5G3A/⌬F508; lane 27, 3120ϩ1G3A/⌬F508; lane 28, R1162X/R1162X; lane 29, 3659delC/⌬F508; lane 30, 3849ϩ10kbC3T/⌬F508; lane 31, S1255X/⌬F508; lane 32, W1282X/G542X; lane 33, N1303K/ϩ. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]

Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 CF 2.8.2 Mutations specific for the African-American population have been described12 and include 3120 ϩ 1GϾA, A559T, G330X, 2307insA, ⌬F311, and G480C. Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Structure of nucleotide-binding domain 1 of the cy... EMBO J. 2004 Jan 28;23(2):282-93. Epub 2003 Dec 18. Lewis HA, Buchanan SG, Burley SK, Conners K, Dickey M, Dorwart M, Fowler R, Gao X, Guggino WB, Hendrickson WA, Hunt JF, Kearins MC, Lorimer D, Maloney PC, Post KW, Rajashankar KR, Rutter ME, Sauder JM, Shriver S, Thibodeau PH, Thomas PJ, Zhang M, Zhao X, Emtage S
Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator.
EMBO J. 2004 Jan 28;23(2):282-93. Epub 2003 Dec 18., 2004-01-28 [PMID:14685259]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is an ATP-binding cassette (ABC) transporter that functions as a chloride channel. Nucleotide-binding domain 1 (NBD1), one of two ABC domains in CFTR, also contains sites for the predominant CF-causing mutation and, potentially, for regulatory phosphorylation. We have determined crystal structures for mouse NBD1 in unliganded, ADP- and ATP-bound states, with and without phosphorylation. This NBD1 differs from typical ABC domains in having added regulatory segments, a foreshortened subdomain interconnection, and an unusual nucleotide conformation. Moreover, isolated NBD1 has undetectable ATPase activity and its structure is essentially the same independent of ligand state. Phe508, which is commonly deleted in CF, is exposed at a putative NBD1-transmembrane interface. Our results are consistent with a CFTR mechanism, whereby channel gating occurs through ATP binding in an NBD1-NBD2 nucleotide sandwich that forms upon displacement of NBD1 regulatory segments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
216 CF mutations in NBD1 The majority of sites of CF-causing missense mutations occur in NBD1, primarily in its a-subdomain, and the locations in the mNBD1 structure of the most common of these (A455E, G480C, I506T, DI507, DF508, S549N, S549R, G551D, A559T, R560T, Y569D, and D648V; Bobadilla et al, 2002) are shown in Figure 3D. Login to comment

[hide] Novel CFTR mutations in black cystic fibrosis pati... Clin Genet. 2004 Apr;65(4):284-7. Feuillet-Fieux MN, Ferrec M, Gigarel N, Thuillier L, Sermet I, Steffann J, Lenoir G, Bonnefont JP
Novel CFTR mutations in black cystic fibrosis patients.
Clin Genet. 2004 Apr;65(4):284-7., [PMID:15025720]

Abstract [show]
Cystic fibrosis (CF) is considered as a rare disease in black Africans. In fact, this disease is likely to be underestimated since clinical features consistent with CF diagnosis are often ascribed to environmental factors such as malnutrition. Very little is known about CFTR mutations in affected patients from Central Africa. We report here four novel mutations, i.e., IVS2 + 28 (intron 2), 459T > A (exon 4), EX17a_EX18del (exons 17-18), and IVS22 + IG > A (intron 22), in such patients. An update of CFTR mutations reported in black patients from various ethnies is included. These data might be helpful for genetic counselling regarding CF in black patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Cystic fibrosis (CF) mutations reported in black patients African-Americans South Africans Central Africans Guianese Mutation n/N Reference Mutation n/N Reference Mutation n/N Reference Mutation 3120þ1G>A 18/148 (7) 3120þ1G>A 11/24 (4) 3120þ1G>A 1/2 (1) 14/112 (1) 2/10 4/6 (2) (1) W19C (7) À94G>T 1/24 (4) 3600þ11.5kbC>G 4/4 (13) IVS22þ1G>A* 405þ3A>C 2/148 (7) 2183delAA 1/24 (4) Y109X* 444delA 1/148 (7, 19) 3196del54 1/24 (4) EX17a-EX18 del* 621G>A (7) G1249E 1/24 (4) IVS2þ28A>G* 1002-3T>G (7) 1/6 (1) 1119delA (7) D1270N 2/10 (2) G330X (7) F311del 1/24 (20) S364P (7) 1342-2delAG (7) 1504delG (7) G480C 2/148 (6, 7) R553X 3/148 (7) A559T 3/148 (7) Y563D (7) I618T (7) R764X (7) 2307insA 3/148 (7, 21) 2734delG/insAT (7) 3662delA (22) 3791delC (7) S1255X 2/148 (7, 23) R1283S (24) W1316X (23) n, number of CF chromosomes with a given mutation; N, total number of CF chromosomes tested. Login to comment

[hide] Bayesian risk assessment for autosomal recessive d... J Med Genet. 2004 May;41(5):e70. Ogino S, Wilson RB, Grody WW
Bayesian risk assessment for autosomal recessive diseases: fetal echogenic bowel with one or no detectable CFTR mutation.
J Med Genet. 2004 May;41(5):e70., [PMID:15121798]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
185 If a relative of parent A or parent B is affected or an obligate carrier, this table can still be applied when neither that relative nor any other family member has been tested. Table 3 Summary of carrier frequencies for cystic fibrosis, overall mutation detection rates by the ACMG 25 mutation panel, and frequencies of major mutations for each major ethnic group (adapted from Richards et al. and Bobadilla et al.)4 18 Ethnic group Cystic fibrosis carrier frequency Overall mutation detection rate by ACMG CFTR 25 mutation panel (%) Frequency DF508 among all disease alleles (%) Other major mutations (%)* Non-Hispanic 1/25 90 70 G542X 2.4 Caucasian G551D 2.1 W1282X 1.4 N1303K 1.3 Ashkenazi Jewish 1/25 97 30 W1282X 48 G542X 9.0 3849+10kbCRT 6.0 N1303K 3.0 1717-1GRA 1.0 African-American 1/65 69 48 3120+1GRA 12 2307insA 2.0 A559T 2.0 R553X 2.0 DF311 2.0 G480C 1.4 405+3ARC 1.4 S1255X 1.4 Hispanic American 1/46 57 46 G542X 5.4 3849+10kbCRT 2.3 R1162X 1.6 R334W 1.6 Asian American 1/90 ? Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 The 27-mutation panel included all of the 16 except S549N and the following additional mutations: 3120 ϩ 1GϾA, 3659delC, A559T, R1162X, S1255X, 405 ϩ 3AϾC, 711 ϩ 1GϾT, 2789 ϩ 5GϾA, G480C, 2307insA, G85E, and 1078delT. Login to comment

[hide] Preconception and prenatal cystic fibrosis carrier... Genet Med. 2004 May-Jun;6(3):141-4. Monaghan KG, Bluhm D, Phillips M, Feldman GL
Preconception and prenatal cystic fibrosis carrier screening of African Americans reveals unanticipated frequencies for specific mutations.
Genet Med. 2004 May-Jun;6(3):141-4., [PMID:15354332]

Abstract [show]
PURPOSE: It is recommended that cystic fibrosis (CF) carrier screening be made available to African Americans who are either pregnant or planning a pregnancy. We analyzed the carrier and mutant allele frequencies for African Americans undergoing CF carrier screening in our laboratories. METHODS: Between December 2001 and September 2003, we performed carrier screening for 2189 African Americans, testing for at least the 25 recommended mutations. RESULTS: A total of 33 CF carriers were identified. The most common mutations detected were deltaF508, G622D, R117H/7T, and G551D. The G622D allele frequency among African Americans was 0.18%. We did not detect any 3120 + 1G --> A carriers, although 4 were expected (P < 0.05). CONCLUSIONS: When considering only the 25 recommended CF mutations, 1 in 75 African Americans screened in our laboratories were carriers (within the expected range, given a 69% mutation detection rate). The addition of 2 mutations, G622D and Q98R (incidentally identified while screening for ACOG/ACMG mutations), increased the observed carrier frequency to 1 in 66, which is not significantly different from the known African American carrier frequency of 1 in 65. The frequencies of several specific mutations detected were unanticipated, as was the absence of 3120 + 1G --> A carriers. Further studies on African American patients with classic CF are needed to examine the incidence of CF mutations that are not part of the current panel, such as G622D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 In addition to ⌬F508 and 3120ϩ1G3A, which are both included in the current mutation panel, other mutations outside of the ACOG/ACMG panel have been reported in African Americans (405ϩ3A3C, 444delA, ⌬F311, G480C, A559T, 2307insA, 196del54, G1249E, S1255X and D1270N6,7,13,14,15). Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Together, A559T and 711ϩ5GϾA were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
76 The most frequent mutations (⌬F508, 3120ϩ1GϾA, 2307insA, and A559T) have been previously reported to be frequent in the African American population19 and represent 46.77% of the total. Login to comment
84 After ⌬F508, the next most-frequent mutations were 3120ϩ1GϾA (8.8%), 2307insA (4.17%), A559T (2.78%), and R553X (1.39%). Login to comment
88 The most frequent mutations were ⌬F508 (52.1%), 3120ϩ1GϾA (9.6%), A559T (6.38%), and R117H (5.32%). Login to comment
122 Similar recommendations have been made by other groups to add mutations that would increase detection in the Hispanic popula- tin.13,18,32 In the African American population, the A559T mutation was the 4th most common mutation among CF patient chromosomes (2.78%) and the third most frequent among CF carriers (6.38%) and as such would warrant inclusion, with 711ϩ5GϾA (0.93%), in any screening program serving an African American population. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

[hide] Nucleotide binding domains of human CFTR: a struct... Cell Mol Life Sci. 2005 Sep;62(18):2112-23. Eudes R, Lehn P, Ferec C, Mornon JP, Callebaut I
Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations.
Cell Mol Life Sci. 2005 Sep;62(18):2112-23., [PMID:16132229]

Abstract [show]
Defective function of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) causes CF, the most frequent lethal inherited disease among the Caucasian population. The structure of this chloride ion channel includes two nucleotide-binding domains (NBDs), whose ATPase activity controls channel gating. Recently, the experimental structures of mouse and human CFTR NBD1 and our model of the human CFTR NBD1/NBD2 heterodimer have provided new insights into specific structural features of the CFTR NBD dimer. In the present work, we provide a structural classification of CF-causing mutations which may complement the existing functional classification. Our analysis also identified amino acid residues which may play a critical role in interdomain interaction and are located at the NBD1-NBD2 interface or on the surface of the dimer. In particular, a cluster of aromatic amino acids, which includes F508 and straddles the two NBDs, might be directly involved in the interaction of the NBD1/NBD2 heterodimer with the channel-forming membrane-spanning domains.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
131 Other examples (fig. 1) are: (i)A455E [38-40] (labeled B in fig. 2); (ii) P574H [40, 41] (labeled S in fig. 2); (iii) A559T [42, 43] (labeled Q in fig. 2). Login to comment
339 (1995) A cystic fibrosis patient who is homozygous for the A559T mutation. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Cancer. 2010 Jan 1;116(1):203-9. McWilliams RR, Petersen GM, Rabe KG, Holtegaard LM, Lynch PJ, Bishop MD, Highsmith WE Jr
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma.
Cancer. 2010 Jan 1;116(1):203-9., 2010-01-01 [PMID:19885835]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are common in white persons and are associated with pancreatic disease. The purpose of this case-control study was to determine whether CFTR mutations confer a higher risk of pancreatic cancer. METHODS: In a case-control study, the authors compared the rates of 39 common cystic fibrosis-associated CFTR mutations between 949 white patients with pancreatic adenocarcinoma and 13,340 white controls from a clinical laboratory database for prenatal testing for CFTR mutations. The main outcome measure was the CFTR mutation frequency in patients and controls. RESULTS: Overall, 50 (5.3%) of 949 patients with pancreatic cancer carried a common CFTR mutation versus 510 (3.8%) of 13,340 controls (odds ratio [OR], 1.40; 95% confidence interval [CI], 1.04-1.89; P = .027). Among patients who were younger when their disease was diagnosed (<60 years), the carrier frequency was higher than in controls (OR, 1.82; 95% CI, 1.14-2.94; P = .011). In patient-only analyses, the presence of a mutation was associated with younger age (median 62 vs 67 years; P = .034). In subgroups, the difference was seen only among ever-smokers (60 vs 65 years, P = .028). Subsequent sequencing analysis of the CFTR gene detected 8 (16%) compound heterozygotes among the 50 patients initially detected to have 1 mutation. CONCLUSIONS: Carrying a disease-associated mutation in CFTR is associated with a modest increase in risk for pancreatic cancer. Those affected appear to be diagnosed at a younger age, especially among smokers. Clinical evidence of antecedent pancreatitis was uncommon among both carriers and noncarriers of CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 * Mutations recommended for screening by the American College of Medical Genetics.16 Mutations not listed but included in the 39-site assay: 3120þ1G>A, R334W, 3569delC, 1078delT, S549N, 3876delA, 1898þ5G>T, 2307insA, Y1092X, M1101K, S1255X, Y122X, A559T; in the 33-site assay: 3120þ1G>A, R334W, 3569delC, S549N, 3876delA, F508C. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Low abundance of sweat duct Cl- channel CFTR in bo... Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12. Brown MB, Haack KK, Pollack BP, Millard-Stafford M, McCarty NA
Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise.
Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12., [PMID:21228336]

Abstract [show]
To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na(+)]), we investigated the relationship among [Na(+)] of thermoregulatory sweat, plasma membrane expression of Na(+) and Cl(-) transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl(-) channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally "salty sweaters" (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with "typical" sweat [Na(+)] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes ("carriers") for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na(+)]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment
119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment

[hide] Cystic fibrosis carrier frequencies in populations... J Med Genet. 1999 Jan;36(1):41-4. Padoa C, Goldman A, Jenkins T, Ramsay M
Cystic fibrosis carrier frequencies in populations of African origin.
J Med Genet. 1999 Jan;36(1):41-4., [PMID:9950364]

Abstract [show]
Cystic fibrosis (CF) is a common autosomal recessive disorder in populations of European descent. However, very little is known about CF in populations of African origin among whom it has been believed to be extremely rare. The aim of this study was to determine if this is the case or whether it is under-reported. A CFTR mutation, 3120+1G-->A, which was first reported in three African-American CF patients, has been shown to account for 9-14% of African-American CF chromosomes. It has also been found in 4/6 CF chromosomes in South African blacks and one CF chromosome of Cameroonian origin. In order to determine the carrier frequency of the 3120+1G-->A mutation in Africa, 1360 unrelated, healthy subjects were screened. Nine carriers were identified. In addition, two out of five black CF patients with positive sweat tests were found to be heterozygous for the 3120+1G-->A mutation and two out of another four black patients with symptoms suggestive of CF, but unconfirmed by sweat tests, were heterozygous for the D1270N mutation. A further three CFTR mutations, A559T, S1255X, and 444delA, which had been found in African-American CF patients, were not identified in the patients or in over 373 healthy subjects tested. The 3120+1G-->A mutation has a carrier frequency of 1 in 91 (8/728) in South African blacks with a 95% confidence interval of 1 in 46 to 1 in 197. Since this mutation accounts for between 15% and 65% of CF chromosomes in South African blacks, a corrected CF carrier frequency would be between 1 in 14 and 1 in 59. Hence, the incidence of CF would be predicted to be between 1 in 784 and 1 in 13924 births in this population. There are several possible reasons why these people are not being detected. Some of these are misdiagnosis as chronic pulmonary infection, malnutrition, tuberculosis, infantile diarrhoea, failure to thrive, or a high infant mortality rate.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 A further three CFTR mutations, A559T, S1255X, and 444delA, which had been found in African-American CF patients, were not identified in the patients or in over 373 healthy subjects tested. Login to comment
15 Together, eight mutations (405+3A→C, 444delA, G480C, R553X, A559T, 2307insA, 3120+1G→A, and S1255X) account for 23.1% of African-American CF chromosomes. Login to comment
27 If the mutations that have also been found in the white population were excluded, the 3120+1G→A mutation would account for 53% of African-American CFTR mutations.4 This mutation has also been found in a black CF patient whose father, the 3120+1G→A carrier, is from Cameroon.8 More recently, the mutation has been identified in three Greek families10 and it has also been shown to be a common CFTR mutation (25% of their CF chromosomes) in Saudi Arabia.11 In an attempt to establish how common CF is in African populations, healthy unrelated subjects were screened for four mutations: 3120+1G→A,9 A559T,12 S1255X,13 and 444delA.14 They occur in African-American CF patients at frequencies of 12.2%, 2.0%, 1.4%, and 0.7%, respectively.4 Subjects and methods DNA samples from 208 San and 1152 unrelated, healthy African blacks from southern, western, and central Africa were studied. Login to comment
33 DNA was extracted using the salting out method.15 MUTATION DETECTION The healthy subjects and the nine patients with symptoms suggestive of CF were screened for four CFTR mutations (3120+1G→A, A559T, 444delA, and S1255X). Login to comment
36 The A559T mutation creates an MseI site generating fragments of 10, 13, 66, 142, and 194 bp when the mutation is present and 10, 13, 66, and 336 bp fragments in the absence of the mutation. Login to comment
49 The mutations F508, G1249E, A559T, S1255X, and 444delA were not found in any of the patients. Login to comment
58 No heterozygotes were identified in 519, 519, and 373 subjects tested for the A559T, S1255X, and 444delA mutations, respectively. Login to comment
59 With a 95% confidence interval, the frequencies of subjects who are carriers for these mutations are low in African populations (0-0.0074 for A559T and S1255X; 0-0.0092 for 444delA)18 and the allele frequencies would be even lower. Login to comment
75 The mutations A559T, S1255X, and 444delA were not found in the unaVected black subjects screened. Login to comment

[hide] CFTR mutations in patients from Colombia: implicat... Hum Mutat. 2003 Sep;22(3):259. Keyeux G, Rodas C, Bienvenu T, Garavito P, Vidaud D, Sanchez D, Kaplan JC, Aristizabal G
CFTR mutations in patients from Colombia: implications for local and regional molecular diagnosis programs.
Hum Mutat. 2003 Sep;22(3):259., [PMID:12938099]

Abstract [show]
Cystic Fibrosis is a worldwide distributed hereditary disease. The incidence of the main (p.F508del) and other frequent mutations has been determined in a great number of countries and ethnic groups, but its incidence in most Latin American countries has remained unknown until recently. It is now beginning to be recognized as a frequent cause of infant mortality, and some countries report the incidence of their mutations. Colombia started several years ago a concerted program of molecular study of patients which were clinically diagnosed as probable cystic fibrosis. We screened the whole CFTR (ABCC7) coding sequence in 92 patients from 6 different geographic regions, using conventional PAGE analyses and DGGE followed by sequencing. Additionally, we established the frequency of the p.F508del mutation in 130 unrelated healthy controls. The results of this pilot study in Colombian patients from various ethnic admixture show six main mutations: p.F508del (41.8%), c.1811+1.6kbA>G (6.5%), p.G542X (3.8%), p.S549R (2.2%), p.W1282X (1.1%) and p.R1162X (1.1%). Thirteen other rare mutations, including three novel, were detected, accounting for a total of 63.6% known mutations. There is a great variability between the geographic regions, both in the frequency of the p.F508del mutation and non-p.F508del CF chromosomes. Our results point to a varied origin of the disease genes. These results also show that careful scrutiny of the mutations is needed in each part of Latin America in order to establish priority-screening protocols adapted to each country and region.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 CFTR Mutation Frequencies in Colombian Cystic Fibrosis Patients MUTATION ANTIOQUIA BOGOTA BOLIVAR CALDAS VALLE OTHER COLOMBIA n=34 n=76 n=20 n=10 n=24 n=20 n=184 N (%) N (%) N (%) N (%) N (%) N (%) N (%) p.F508del 16 (47.1) 31 (40.8) 5 (25) 6 (60.0) 10 (41.7) 9 (45.0) 77 (41.8) c.1811+1.6KbA>G 0 8 (10.5) 2 (10.0) 0 1 (4.2) 1 (5.0) 12 (6.5) p.G542X 0 4 (5.3) 0 0 2 (8.3) 1 (5.0) 7 (3.8) p.S549R 1 (2.9) 3 (3.9) 0 0 0 0 4 (2.2) p.W1282X 0 1 (1.3) 0 0 1 (4.2) 0 2 (1.1) p.R1162X 0 0 2 (10.0) 0 0 0 2 (1.1) p.A559T 1 (2.9) 0 0 0 0 0 1 (0.5) p.Y1092X 0 0 1 (5.0) 0 0 0 1 (0.5) p.R334W 0 0 0 0 1 (4.2) 0 1 (0.5) c.1215delG 0 1 (1.3) 0 0 0 0 1 (0.5) c.2185_2186insC 0 0 0 0 0 1 (5.0) 1 (0.5) c.2789+5G>A 0 0 0 0 1 (4.2) 0 1 (0.5) c.3120+1G>A 0 0 1 (5.0) 0 0 0 1 (0.5) c.3849+1G>A 0 1 (1.3) 0 0 0 0 1 (0.5) p.R1066C 0 1 (1.3) 0 0 0 0 1 (0.5) p.N1303K 1 (2.9) 0 0 0 0 0 1 (0.5) c.3500-2A>G* 1 (2.9) 0 0 0 0 0 1 (0.5) c.1323_1324insA* 0 0 1 (5.0) 0 0 0 1 (0.5) p.H609R* 0 0 0 0 0 1 (5.0) 1 (0.5) Unidentified 14 (41.2) 26 (34.2) 8 (40.0) 4 (40.0) 8 (33.3) 7 (35) 67 (36.4) The regions of the country where few patients were studied are grouped as other. Login to comment
69 Comparison of the Spectrum of CFTR Mutations in Colombia and Other Ibero-American Countries COLOMBIA1 SPAIN2 MEXICO3 ARGENTINA4 BRAZIL5 MUTATION n=92 n=1356 n=194 n=228 n=272 % % % % % p.F508del 41.8 54.42 40.72 57 45.6 p.G542X 3.8 7.7 6.18 3.94 6.6 p.W1282X 1.1 0.5 0 3.07 2.2 p.R1162X 1.1 1.3 0 0.43 4.4 p.N1303K 0.5 2.5 2.06 1.75 2.9 c.1811+1.6KbA>G 6.5 1.5 0 0.43 0 p.S549R 2.2 0.07 0 0 0 p.A559T 0.5 0 0 0 0 p.Y1092X 0.5 0.01 0.51 0 0 p.R334W 0.5 0.9 0 0 2.9 c.1215delG 0.5 0 0 0 0 c.2185_2186insC 0.5 0 0 0 0 c.2789+5G>A 0.5 0.7 0 0.43 0 c.3120+1G>A 0.5 0 0 0 0 c.3849+1G>A 0.5 0 0 0 0 p.R1066C 0.5 0.7 0 0.43 0 c.3500-2A>G (novel) 0.5 0 0 0 0 c.1323_1324insA (novel) 0.5 0 0 0 0 p.H609R (novel) 0.5 0 0 0 0 Other a (# mutations) - (32) 1.8 (30) 5.28 (9) 4.89 (8) 6.98 Unknown 36.4 17.9 25.25 27.63 28.3 a The frequencies of the other rare mutations found in Spain, Mexico, Argentina and Brazil are pooled together, and the number of different mutations is given in parenthesis. Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 For example, the p.Q98X and p.Q98R mutations in exon 4; and p.S466X and p.S492F mutations in exon 10, were detected in the temperature range of 52-607C and 51- 577C, respectively. The p.G542X, p.R553X, p.S549N, and p.A559T in exon 11; p.A561E, c.189811G.A, and c.189813A.G in exon 12; and p.W1204X in exon 19; were detected in the temperature range of 51 to 567C. Login to comment
96 Detection of known mutations and polymorphisms by TTGE Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles detected 1 c.386G.A p.G85E 3 Heterozygote Mutation 2 2 c.575T.C p.I148T 4 Heterozygote Mutation 2 3 c.406-1G.A Splice Int 4 Heterozygote Mutation 9 4 c.71111G.T Splice Int 5 Heterozygote Mutation 1 5 c.1059_1069del 3bp p.F311del 7 Heterozygote Mutation 2 6 c.1132C.T p.R334W 7 Heterozygote Mutation 2 7 c.1652_1655del 3bp p.F508del 10 Heterozygote Mutation 94 8 Homozygote Mutation 12 c.1540A/G p.M470V 10 Heterozygote Polymorphism 15 9 Homozygote Polymorphism 4 c.1756G.T p.G542X 11 Heterozygote Mutation 13 10 c.1784G.A p.G551D 11 Heterozygote Mutation 1 11 c.1778G.A p.S549N 11 Heterozygote Mutation 4 12 c.1789C.T p.R553X 11 Homozygote Mutation 2 13 c.1807G.A p.A559T 11 Heterozygote Mutation 2 14 c.189811G.A Splice Int 12 Heterozygote Mutation 1 15 c.1949del84bp Frameshift 13 Heterozygote Mutation 3 16 c.278915G.A Splice Int 14b Heterozygote Mutation 2 17 c.312011G.A Splice Int 16 Heterozygote Mutation 9 18 c.3171delC Frameshift 17a Heterozygote Mutation 1 19 c.3398G.A p.W1089X 17b Heterozygote Mutation 1 20 c.3425G.A p.W1098X 17b Heterozygote Mutation 1 21 c.3616C.T p.R1162X 19 Heterozygote Mutation 2 22 c.3791delC Frameshift 19 Heterozygote Mutation 1 23 c.3821delT Frameshift 19 Heterozygote Mutation 1 24 c.3876delA Frameshift 20 Heterozygote Mutation 4 25 c.3905insT Frameshift 20 Heterozygote Mutation 1 26 c.4041C.G p.N1303K 21 Heterozygote Mutation 2 Total 194 The translation starts at c.133 of CFTR CDNA sequence in GenBank Acc. Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Disease-associated nsSNPs at Three Structural Hotspots in Human ABC Transporter NBDs Gene Disease Position ARA motif ABCB11 BRIC2 A570T ABCD1 X-ALD A616V CFTR CF A559T ABCC6 PXE R765Q ABCC8 HHF1 R841G ABCC8 HHF1 R1493Q ABCC8 HHF1 R1493W ABCD1 X-ALD R617C ABCD1 X-ALD R617G ABCD1 X-ALD R617H CFTR CF R560K CFTR CF R560S CFTR CF R560T ABCA1 HDLD1 A1046D ABCB4 ICP A546D C-loop 1 motif ABCC8 HHF1 D1471H ABCC8 HHF1 D1471N CFTR CBAVD G544V ABCC8 HHF1 G1478R C-loop2 motif ABCA4 STGD1 H2128R ABCC8 HHF1 K889T ABCD1 X-ALD R660P ABCD1 X-ALD R660W ABCA1 HDLD2 M1091T ABCA4 STGD1 E2131K ABCA12 LI2 E1539K ABCA4 STGD1 and CORD3 E1122K CFTR CF L610S ABCC8 HHF1 L1543P ABCA1 Colorectal cancer sample; somatic mutation A2109T ABCC9 CMD1O A1513T ABCD1 X-ALD H667D CFTR CF A613T ABCA1 HDLD2 D1099Y ABCD1 X-ALD T668I CFTR CF D614G ABCA4 STGD1 R2139W ABCA4 STGD1 R1129C ABCA4 ARMD2, STGD1, and FFM R1129L Disease abbreviations are as follows: BRIC2, benign recurrent intrahepatic cholestasis type 2; X-ALD, X-linked adrenoleukodystrophy; CF, cystic fibrosis; PXE, Pseudoxanthoma elasticum; HHF1, familial hyperinsulinemic hypoglycemia-1; HDLD1, high density lipoprotein deficiency type 1; ICP, intrahepatic cholestasis of pregnancy; CBAVD, congenital bilateral absence of the vas deferens; STGD1, Stargardt disease type 1; HDLD2, high density lipoprotein deficiency type 2; LI2, ichthyosis lamellar type 2; CORD3, cone-rod dystrophy type 3; CMD1O, cardiomyopathy dilated type 1O; ARMD2, age-related macular degeneration type 2; FFM, fundus flavimaculatus. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

[hide] Cystic fibrosis: a multiple exocrinopathy caused b... Am J Med. 1998 Jun;104(6):576-90. Schwiebert EM, Benos DJ, Fuller CM
Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein.
Am J Med. 1998 Jun;104(6):576-90., [PMID:9674722]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
223 They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X). Login to comment

[hide] Modeling of nucleotide binding domains of ABC tran... J Bioenerg Biomembr. 1997 Oct;29(5):503-24. Bianchet MA, Ko YH, Amzel LM, Pedersen PL
Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Bioenerg Biomembr. 1997 Oct;29(5):503-24., [PMID:9511935]

Abstract [show]
Members of the ABC transporter superfamily contain two nucleotide binding domains. To date, the three dimensional structure of no member of this super-family has been elucidated. To gain structural insight, the known structures of several other nucleotides binding proteins can be used as a framework for modeling these domains. We have modeled both nucleotide binding domains of the protein CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) using the two similar domains of mitochondrial F1-ATPase. The models obtained, provide useful insights into the putative functions of these domains and their possible interaction as well as a rationale for the basis of Cystic Fibrosis causing mutations. First, the two nucleotide binding domains (folds) of CFTR are each predicted to span a 240-250 amino acid sequence rather than the 150-160 amino acid sequence originally proposed. Second, the first nucleotide binding fold, is predicted to catalyze significant rates of ATP hydrolysis as a catalytic base (E504) resides near the y phosphate of ATP. This prediction has been verified experimentally [Ko, Y.H., and Pedersen, P.L. (1995) J. Biol. Chem. 268, 24330-24338], providing support for the model. In contrast, the second nucleotide binding fold is predicted at best to be a weak ATPase as the glutamic acid residue is replaced with a glutamine. Third, F508, which when deleted causes approximately 70% of all cases of cystic fibrosis, is predicted to lie in a cleft near the nucleotide binding pocket. All other disease causing mutations within the two nucleotide binding domains of CFTR either reside near the Walker A and Walker B consensus motifs in the heart of the nucleotide binding pocket, or in the C motif which lies outside but near the nucleotide binding pocket. Finally, the two nucleotide binding domains of CFTR are predicted to interact, and in one of the two predicted orientations, F508 resides near the interface. This is the first report where both nucleotide binding domains of an ABC transporter and their putative domain-domain interactions have been modeled in three dimensions. The methods and the template used in this work can be used to analyze the structures and function of the nucleotide binding domains of all other members of the ABC transporter super-family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
360 The CFTR NBD1 model that results (Fig. 6) gathers the disease causing mutations in three different clusters: (1) mutations affecting the nucleotide binding pocket and the putative general base: A455E, G458V, E504Q AI507 AF508 P574H; (2) mutations in motif C which are probably related to an interaction with region D: S549[R,N,I] G551[S,D], R553Q; and (3) mutations within or near motif B, L558S, A559T, R560T, Y563N and mutations S492F and G480C. Login to comment

[hide] Identification of common cystic fibrosis mutations... Am J Hum Genet. 1997 May;60(5):1122-7. Macek M Jr, Mackova A, Hamosh A, Hilman BC, Selden RF, Lucotte G, Friedman KJ, Knowles MR, Rosenstein BJ, Cutting GR
Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%.
Am J Hum Genet. 1997 May;60(5):1122-7., [PMID:9150159]

Abstract [show]
Cystic fibrosis (CF)--an autosomal recessive disorder caused by mutations in CF transmembrane conductance regulator (CFTR) and characterized by abnormal chloride conduction across epithelial membranes, leading to chronic lung and exocrine pancreatic disease--is less common in African-Americans than in Caucasians. No large-scale studies of mutation identification and screening in African-American CF patients have been reported, to date. In this study, the entire coding and flanking intronic sequence of the CFTR gene was analyzed by denaturing gradient-gel electrophoresis and sequencing in an index group of 82 African-American CF chromosomes to identify mutations. One novel mutation, 3120+1G-->A, occurred with a frequency of 12.3% and was also detected in a native African patient. To establish frequencies, an additional group of 66 African-American CF chromosomes were screened for mutations identified in two or more African-American patients. Screening for 16 "common Caucasian" mutations identified 52% of CF alleles in African-Americans, while screening for 8 "common African" mutations accounted for an additional 23%. The combined detection rate of 75% was comparable to the sensitivity of mutation analysis in Caucasian CF patients. These results indicate that African-Americans have their own set of "common" CF mutations that originate from the native African population. Inclusion of these "common" mutations substantially improves CF mutation detection rates in African-Americans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 In the two independent African-American groups, samples were screened for eight mutations that have been identified in two or more African-American CF patients, including 405+3A-+C (present study), 444delA (White et al. 1991), G480C (Smit et al. 1995), R553X (Cutting et al. 1990b), A559T (Cutting et al. 1990b), 2307insA (Smit et al. 1993), 3120+1G-+A (present study), and S1255X (Cutting et al. Login to comment
48 The A559T mutation creates a unique MseI restriction site. Login to comment
61 Four other mutations were observed more than once in the index group (405+3A--C [2], R553X [3], A559T [2], and S1255X [2]). Login to comment
62 Twelve novel mutations were identified in one patient each: W19C, 621G--*A, 1002-3T-*G, Am. J. Hum. Genet. Login to comment
86 The most common muta- Table 2 Distribution of CF Mutations in African-American and U.S.-Caucasian CF Patients African-American U.S. Caucasiana Mutation (n= 148) % (n = 8,714) % Caucasian mutations: AF508 71 48 5,769 66.2 R117H 0 0 47 .5 621+1 G--T 0 0 68 .8 R334W 1 .7 7 .1 R347P 0 0 24 .3 A455E 0 0 5 .1 AI507 1 .7 10 .1 1717-1 G-IA 1 .7 39 .5 G542X 1 .7 204 2.3 S549N 1 .7 4 .1 GS51D 1 .7 173 2.0 R553X (Caucasian)b 0 0 87 1.0 R560T 0 0 16 .2 3849+10kb C-T 0 0 51 .6 W1282X 0 0 235 2.7 N1303K 0 0 116 1.3 Subtotal 77 52 6,855 78.7 African-American mutations: 405+3 A-C 2 1.4 ... ... 444delA 1 .7 ... ... G480C 2 1.4 ... ... R553X (African)b 3 2.0 ... ... A559T 3 2.0 ... ... 2307insA 3 2.0 ... ... 3120+1 GC-A 18 12.2 ... ... S1255X 2 1.4 ... ... Subtotal 34 23 ... ... Total 111 75.0 6,855 78.7 NOTE.-Percentages are rounded. Login to comment
46 In the two independent African-American groups, samples were screened for eight mutations that have been identified in two or more African-American CF patients, including 405+3A-+C (present study), 444delA (White et al. 1991), G480C (Smit et al. 1995), R553X (Cutting et al. 1990b), A559T (Cutting et al. 1990b), 2307insA (Smit et al. 1993), 3120+1G-+A (present study), and S1255X (Cutting et al. Login to comment
49 The A559T mutation creates a unique MseI restriction site. Login to comment
87 The most common muta- Table 2 Distribution of CF Mutations in African-American and U.S.-Caucasian CF Patients African-American U.S. Caucasiana Mutation (n= 148) % (n = 8,714) % Caucasian mutations: AF508 71 48 5,769 66.2 R117H 0 0 47 .5 621+1 G--T 0 0 68 .8 R334W 1 .7 7 .1 R347P 0 0 24 .3 A455E 0 0 5 .1 AI507 1 .7 10 .1 1717-1 G-IA 1 .7 39 .5 G542X 1 .7 204 2.3 S549N 1 .7 4 .1 GS51D 1 .7 173 2.0 R553X (Caucasian)b 0 0 87 1.0 R560T 0 0 16 .2 3849+10kb C-T 0 0 51 .6 W1282X 0 0 235 2.7 N1303K 0 0 116 1.3 Subtotal 77 52 6,855 78.7 African-American mutations: 405+3 A-C 2 1.4 ... ... 444delA 1 .7 ... ... G480C 2 1.4 ... ... R553X (African)b 3 2.0 ... ... A559T 3 2.0 ... ... 2307insA 3 2.0 ... ... 3120+1 GC-A 18 12.2 ... ... S1255X 2 1.4 ... ... Subtotal 34 23 ... ... Total 111 75.0 6,855 78.7 NOTE.-Percentages are rounded. Login to comment

[hide] Missense mutation R1066C in the second transmembra... Hum Mutat. 1997;10(5):387-92. Casals T, Pacheco P, Barreto C, Gimenez J, Ramos MD, Pereira S, Pinheiro JA, Cobos N, Curvelo A, Vazquez C, Rocha H, Seculi JL, Perez E, Dapena J, Carrilho E, Duarte A, Palacio AM, Nunes V, Lavinha J, Estivill X
Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: study of 19 heterozygous and 2 homozygous patients.
Hum Mutat. 1997;10(5):387-92., [PMID:9375855]

Abstract [show]
We report the clinical features of 21 unrelated cystic fibrosis (CF) patients from Portugal and Spain, who carry the mutation R1066C in the CFTR gene. The current age of the patients was higher in the R1066C/any mutation group (P < 0.01), as compared to the deltaF508/deltaF508 group. Poor values for lung radiological involvement (Chrispin-Norman) and general status (Shwachman-Kulcycki) were observed in the R1066C/any mutation group (P < 0.005 and P < 0.0004). A slightly, but not significantly worse lung function was found in the R1066C/any mutation group when compared with the deltaF508/deltaF508 patients. No significant differences were detected regarding the age at diagnosis, sweat Cl-values, or percentiles of height and weight between the two groups. Neither were significant differences observed regarding sex, meconium ileus (4.7% vs. 11.1%), dehydration (10.5% vs. 14.7%), or pancreatic insufficiency (PI) (100% vs. 97.8%). The proportion of patients with lung colonization by bacterial pathogens was slightly, but not significantly higher in the R1066C/any mutation group (70.0%), as compared with the deltaF508/deltaF508 group (57.5%). Other clinical complications were significantly more frequent in the R1066C/any mutation patients(P < 0.02) than in the deltaF508/deltaF508 group. The two homozygous R1066C/R1066C patients died at the ages of 3 months and 7 years. The data presented in this study clearly demonstrate that the R1066C mutation is responsible for a severe phenotype similar to that observed in homozygous deltaF508 patients. The poor clinical scores and complications of patients with the R1066C mutation are probably related to their slightly longer survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 (Strong et al., 1991), E92K (Nunes et al., 1993), S549N (Curtis et al., 1993), I175V (Romey et al., 1994), A559T (McDowell et al., 1995), and G85E (Vázquez et al., 1996). Login to comment

[hide] Cystic fibrosis mutation detection by hybridizatio... Hum Mutat. 1996;7(3):244-55. Cronin MT, Fucini RV, Kim SM, Masino RS, Wespi RM, Miyada CG
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum Mutat. 1996;7(3):244-55., [PMID:8829658]

Abstract [show]
We have combined photochemistry and photolithography with solid-phase DNA synthesis chemistry to form a new technology that makes high density oligonucleotide probe array synthesis possible. Hybridization to these two-dimensional arrays containing hundreds or thousands of oligonucleotide probes provides a powerful DNA sequence analysis tool. Two types of light-generated DNA probe arrays have been used to test for a variety of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. One array, made up of 428 probes, was designed to scan through the length of CFTR exon 11 and identify differences from the wild type reference sequence. The second type of array contained 1480 probes chosen to detect known deletions, insertions, or base substitution mutations. The validity of the probe arrays was established by hybridizing them with fluorescently labeled control oligonucleotide targets. Characterized mutant CFTR genomic DNA samples were then used to further test probe array hybridization specificity. Finally, ten unknown patient samples were genotyped using the CFTR probe array assay. The genotype assignments were identical to those obtained by PCR product restriction fragment analysis. Our results show that light-generated DNA probe arrays are highly effective in analyzing complex mutation and polymorphism patterns in a relatively large gene such as CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design. Login to comment

[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]

Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Molecular mechanisms of CFTR chloride channel dysf... Cell. 1993 Jul 2;73(7):1251-4. Welsh MJ, Smith AE
Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis.
Cell. 1993 Jul 2;73(7):1251-4., [PMID:7686820]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 Classes of CFTR Mutations That Cause CF Class Defect Examples Do- Fre- Clin- main quency ical Protein production Nonsense mutations Frameshift Splice Processing Conduction 6542X NBDI 3.4 3905 insT NBD2 2.1 621 + G-T MSDl 1.3 Al507 NBDl AF506 NBDl s5491 NBDl S549R NED1 A559T NED1 N1303K NBDP G551 D NBDl G551S NBDl G1244E NBDP S1255P NBDP G1349D NBDP RI 17H MSDI R334W MSDl R347P MSDl 0.5 67.2 Rare 0.3 Rare 1.a 2.4 Rare Rare Rare Rare 0.6 0.4 0.5 PI PI PI PI PI PI PI PI PS PI PI PI PS PS PS NED, nucleotide-binding domain; MSD, membrane-spanning domain; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Cloning and sequence analysis of rat cystic fibros... Am J Physiol. 1992 Jun;262(6 Pt 1):L779-84. Fiedler MA, Nemecz ZK, Shull GE
Cloning and sequence analysis of rat cystic fibrosis transmembrane conductance regulator.
Am J Physiol. 1992 Jun;262(6 Pt 1):L779-84., [PMID:1377454]

Abstract [show]
A complementary DNA (cDNA) encoding the rat cystic fibrosis transmembrane conductance regulator (CFTR) has been isolated and the tissue distribution of the rat CFTR mRNA has been determined. Northern blot analysis revealed that the highest levels of the 6.3 kilobase (kb) CFTR mRNA were expressed in the colon, with expression also noted in uterus, lung, stomach, and small intestine. A 7.5-kb mRNA was expressed in skeletal muscle, and in testes both the 7.5-kb mRNA and a 6.0-kb mRNA were expressed. Five cDNAs were isolated from a rat colon library, the longest corresponding to codons 684 through the poly A tail. Three other clones, corresponding to codons 213 through 245, 372 through 574, and 656 through 886 were also isolated. Polymerase chain reaction amplification of cDNA prepared from rat colon mRNA was utilized to clone the remainder of the cDNA. The predicted amino acid sequence of the rat CFTR is 79% identical to the human CFTR, with 73% identity noted in the R domain, and 81 and 83% identities noted in nucleotide binding folds 1 and 2, respectively. Thirty-two of the 38 potential phosphorylation sites identified in the human CFTR were also present in the rat CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
487 Cutting et al. (7) identified a cluster of mutations in NBFl (R533stop, S549N, G551D, and A559T), which are associated with the CF phenotype. Login to comment

[hide] Cystic fibrosis with three mutations in the cystic... Hum Genet. 1991 Aug;87(4):441-6. Dork T, Wulbrand U, Richter T, Neumann T, Wolfes H, Wulf B, Maass G, Tummler B
Cystic fibrosis with three mutations in the cystic fibrosis transmembrane conductance regulator gene.
Hum Genet. 1991 Aug;87(4):441-6., [PMID:1715308]

Abstract [show]
Three mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene were discovered in a pancreas-insufficient patient with cystic fibrosis (CF) who displayed an uncommon combination of almost normal chloride concentration in sweat tests and typical symptoms of gastrointestinal and pulmonary disease. The R553Q mutation was found on the maternal delta F508-CFTR gene. Codon 553 is located within a consensus motif of the ATP-binding cassette transport proteins at a less conserved position. Other members of this protein superfamily contain a glutamine instead of arginine at the homologous position, suggesting a modulating rather than disease-causing role of the R553Q mutation in CFTR. The amplification refractory mutation system did not detect the R553Q mutation in a further 65 normal, 113 delta F508, and 91 non-delta F508 CF chromosomes. The index case carried the R553X nonsense mutation on the paternal chromosome. The R553X mutation was present on a further 9 out of 86 German non-delta F508 CF chromosomes linked with the XV2c-KM19-Mp6d9-J44-GATT haplotypes 2-2-2-1-1 and 1-1-2-1-2. The location of R553X on separate haplotypes including both alleles of the intragenic GATT repeat suggests an ancient and/or multiple origins of the R553X mutations. The association of the genotype of the CFTR mutation and the clinical phenotype was assessed for the patients carrying the related genotypes delta F508/delta F508 (n = 80), delta F508/R553X (n = 9) and delta F508-R553Q/R553X (n = 1). In compound heterozygotes, the median chloride concentration in pilocarpine iontophoresis sweat tests was significantly lower than in the delta F508 homozygotes (P less than 0.01). The patient groups were significantly different with respect to the distributions of the centiles for height (P less than 0.001) and weight (P less than 0.01) as the most sensitive predictors of the course and prognosis in CF. Growth retardation was more pronounced in the compound heterozygotes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 Interestingly, the disease-causing missense mutations in this region of CFTR, S549(N,I,R), G551D, and A559T (Cutting et al. 1990; Kerem et al. 1990) all affect conserved residues in this consensus sequence, indicating that the amino acids at positions 2, 4, and 12 are essential for the function and/or processing of the CFTR protein. Login to comment

[hide] Simultaneous screening for 11 mutations in the cys... Mol Cell Probes. 1992 Feb;6(1):33-9. Cuppens H, Buyse I, Baens M, Marynen P, Cassiman JJ
Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot.
Mol Cell Probes. 1992 Feb;6(1):33-9., [PMID:1372093]

Abstract [show]
An assay is described in which 11 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can be screened simultaneously. Six different exons of the CFTR gene are amplified in a single multiplex amplification. Biotinylated dUTP is incorporated into the different fragments during the amplification process. A sample of this mixture is then hybridized to 21 different poly-dT tailed oligonucleotide probes which are bound to a nylon membrane. In order to screen the different mutations in a single step hybridization, the length of the different oligonucleotides and the amount used in the assay were optimized. The detection is performed by binding avidin-alkaline phosphatase to the biotin, followed by a chemiluminescent reaction. By means of this fast and sensitive assay, about 85% of all the cystic fibrosis mutations in the Belgian population can be detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population . Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
51 Table 2 p.I507del p.S549N p.S549R p.G551D p.G551S p.R553X p.L558S p.A559T p.S589I p.H609RÌe; p.P750L p.V754M p.R851L p.I1027T p.G1061R p.R1066C p.W1069X# p.W1089X p.Y1092X p.W1098CÌe; p.W1204X 3 0 1 0 1 1 1 1 1 0 4 1 2 3 1 3 0.24 1 0.08 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 4 0.32 1 0.08 1 4 1 2 1 1 0 0 0 1 0 0 0 1 1 0 1 0 2 0 1 3 0 0 0 0 0 0 1 0.05 1 0.05 1 0.05 10 0.54 1 0.05 2 0.11 3 0.16 3 0 0 0 1 0 1 1 2 0.79 4 1.58 4 1 1 1 1 4 1.83 1 0.46 1 0.46 1 0.46 1 0.46 0 0 0 0 0 0 0 5 5 1 1 1 1 1 1 1 1 1 1 1 5 1.82 6 2.19 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 1.31 1 1.31 1 1.31 10 6 6 6 1 22 1 1 2 1 1 1 1 1 1 6 1 3 5 1 1 0.23 0.14 0.14 0.14 0.02 0.51 0.02 0.02 0.05 0.02 0.02 0.02 0.02 0.02 0.02 0.14 0.02 0.07 0.11 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country p.Q1238X p.R1283M c.-834GNT c.297-1GNA* c.297-2ANG c.406-1GNA c.621+1GNT c.711+1GNT c.846delT* c.935delA c.1078delT c.1215delG c.1323_1324insA* c.1353_1354insT*# c.1460_1461delAT* Argentina 1 3 1 1 1 1 1 Subtotal and frequency (%) 1 0.08 1 0.08 4 0.32 1 0.08 1 0.08 1 0.08 Brazil 1 1 1 1 0 0 Subtotal and frequency (%) 1 0.05 2 0.11 1 0.05 Chile 0 0 Subtotal and frequency (%) Colombia 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 Costa Rica Frequency (%) 0 Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 1 3 1 2 1 1 Subtotal and frequency (%) 1 0.36 3 1.09 1 0.36 1 0.36 2 0.73 1 0.36 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 1 1 1 1 1 3 7 2 1 2 1 1 1 1 1 Frequency (%) 0.02 0.02 0.02 0.02 0.02 0.07 0.16 0.05 0.02 0.05 0.02 0.02 0.02 0.02 0.02 (continued ) Table 2 c.1716GNA c.1717-1GNA c.1782delA c.1811+1,6KbANG c.1812-1GNA c.1898+1GNA c.1898+3ANG c.1924_1930del c.2055_2063del c.2183AANG;c.2184delA c.2184delA c.2185_2186insC 5 1 4 1 1 1 0 1 2 2 6 0.48 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 1 0.08 1 0 6 5 1 3 0 0 0 0 7 0.37 5 0.27 1 0.05 3 0.16 0 0 12 1 12 5.50 1 0.46 0 0 1 1 2 2 1 0.36 1 0.36 2 0.73 2 0.73 1 1.31 1 14 1 18 5 3 1 1 2 6 1 1 0.02 0.32 0.02 0.41 0.11 0.07 0.02 0.02 0.05 0.14 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country c.2347delG c.2566_2567insT* c.2594_2595delGT* c.2686_2687insT* c.2789+2_2789+3insA c.2789+5GNA c.2869_2870insG c.3120+1GNA c.3171delC c.3199_3204del c.3272-26ANG c.3500-2ANG* Argentina 2 1 2 2 3 3 1 1 2 Subtotal and frequency (%) 2 0.16 1 0.08 2 0.16 2 0.16 6 0.48 1 0.08 1 0.08 2 0.16 Brazil 2 1 1 1 6 0 0 4 0 Subtotal and frequency (%) 2 0.11 1 0.05 1 0.05 10 0.54 1 0.05 Chile Subtotal and frequency (%) Colombia 1 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 1 0.46 Costa Rica Frequency (%) Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 2 Subtotal and frequency (%) 2 0.73 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 2 2 1 3 2 9 1 12 1 2 2 1 Frequency (%) 0.05 0.05 0.02 0.07 0.05 0.21 0.02 0.28 0.02 0.05 0.05 0.02 (continued ) Table 2 c.3617_3618delGA*,# c.3659delC c.3849+1GNA c.3849+10kbCNT c.4005+1GNA c.4005-1GNA# c.4016_4017insT c.4160_4161insGGGG* c.IVS8-5T Unknown Authors 37 Aulehla-Scholz [17] 2 4 1 2 4 76 Visich [12] 1 78 Iba&#f1;ez [18] 54 Varela 2004 8 Prieto [19] 2 1 1 1 18 Oller-Ramirez 2004 4 0.32 6 0.48 1 0.08 1 0.08 2 0.16 5 0.40 271 21.75 205 Raskin [20] 32 Chiba [21] 1 89 Bernardino [22] 60 Marostica [23] 69 Parizotto [24] 99 Cabello [25,26] 33 Martins [27] 70 Streit [28] 0 5 120 Raskin [15] 0 0 12 Goloni-Bertollo [29] 1 0.05 5 0.27 789 42.46 48 Rios [30] 22 Molina [31] 1 11 Navarro [32] 0 3 34 Repetto [33] 4 1.58 115 45.63 1 67 Keyeux [14] 17 Restrepo [34] 1 0.46 84 38.53 0 25 52.08 Venegas [35] 95 65.97 Collazo [36] 20 Merino [37] 30 Cassiman 2004 15 Paz-y-Mino [38] 65 63.72 1 1 53 Orozco [13] 2 35 Villalobos [39] 3 1.09 1 0.36 88 32.11 11 14.47 Luzardo [40,41] 36 Restrepo [34] 41 Alvarado [42] 77 56.62 1 4 1 18 1 1 2 1 5 1620 0.02 0.09 0.02 0.41 0.02 0.02 0.05 0.02 0.11 37.21 Mutation frequencies in Latin American CF patients most frequently found in Caucasians, by allele specific polymerase chain reaction (AS-PCR), enzymatic digestion, allele specific oligonucleotide hybridization (ASO), or using mainly commercial kits, whereas other studies used a systematic approach to analyse the promoter, coding and exon/ intron boundaries of the CFTR region in the search for any possible mutation. Login to comment
98 As an example, in the case of Argentina and Uruguay, the p.F508del mutation shows the highest frequencies (59% and Table 5 Mutations with frequencies less than 0.1% Panel A Mutation Number of chromosomes % Country p.R75X 3 0.07 Mexico c.W1089X 3 0.07 Argentina, Brazil c.406-1GNA 3 0.07 Mexico c.1898+1GNA 3 0.07 Argentina, Brazil c.2686_2687insTÌe; 3 0.07 Argentina, Brazil p.L206W 2 0.05 Brazil p.I506T 2 0.05 Mexico p.S589I 2 0.05 Argentina c.711+1GNT 2 0.05 Argentina c.935delA 2 0.05 Mexico c.2055_2063del 2 0.05 Mexico c.2347delG 2 0.05 Brazil c.2566_2567insTÌe; 2 0.05 Argentina c.2789+2_2789+3insA 2 0.05 Argentina c.3199_3204del 2 0.05 Mexico c.3272-26ANG 2 0.05 Argentina c.4016_4017insT 2 0.05 Argentina Panel B Mutation N % each Country p.L6VÌe;, p.W57X, p.Q220X, p.Y362XÌe;, p.I1027T, p.G1061R, p.R1283M, c.297-2ANG, c.1353_1354insTÌe;, c.1460_1461delATÌe;, c.1782delA, c.1898+3ANG, c.2184delA, c.2594_2595delGTÌe;, c.2869_2870insG, c.4005Ìe;1GNA, c.4005-1GNA# 17 0.02 Argentina p.R117H, p.H199Y, p.G551S, p.L558S, p.P750L, p.V754M, p.W1069X#, p.W1098CÌe;, p.W1204X, c.297-1GNAÌe;, c.846delTÌe;, c.1078delT, c.1716GNA, c.1924_1930del, c.4160_4161insGGGGÌe; 15 0.02 Mexico p.V201M, p.V232D, p.Y275XÌe;, p.R347P, p.R851L, p.Q1238X, c.3171delC, c.3617_3618delGAÌe;# 8 0.02 Brazil p.A559T, p.H609RÌe;, c.1215delG, c.1323_1324insAÌe;, c.2185_2186insC, c.3500-2ANGÌe;, c.3849+1GNA, 7 0.02 Colombia c.-834GNT 1 0.02 Uruguay The upper part (Panel A) shows the mutations found in more than one patient, whereas the lower part (Panel B) of the table shows all the mutations that are present only once in each country. Login to comment
110 Actually, two African mutations (p.A559T and c.3120+1GNA) have been found in two regions with high African admixture in Colombia (Bolivar and Antioquia-Choc&#f3;) [14], and the c.3120+1G-NA mutation has also been found in Brazil [15, 26], with a frequency of 4% in Rio de Janeiro, and Argentina (Oller Ramirez, personal communication). Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1G࢐T, 711+1G࢐T, G551D, R334W, R347P, A455E, 1717-1G࢐A, R560T, R553X, N1303K, 1898+1G࢐A, 2184delA, 2789+5G࢐A, 3120+1G࢐A, R1162X, 3659delC, 3849+10kbC࢐T, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5G࢐T, 2183AA࢐G, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT. Login to comment
84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbC࢐T* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1G࢐A* 4 1.6 0.7 (1) 621+1G࢐T* 3 1.2 0.9 (1) 3120+1G࢐A* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5G࢐A* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1G࢐T* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1G࢐A* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5G࢐T 0 0 Undetermined (1) 2183AA࢐G 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens. Login to comment

[hide] Novel CFTR variants identified during the first 3 ... J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28. Prach L, Koepke R, Kharrazi M, Keiles S, Salinas DB, Reyes MC, Pian M, Opsimos H, Otsuka KN, Hardy KA, Milla CE, Zirbes JM, Chipps B, O'Bra S, Saeed MM, Sudhakar R, Lehto S, Nielson D, Shay GF, Seastrand M, Jhawar S, Nickerson B, Landon C, Thompson A, Nussbaum E, Chin T, Wojtczak H
Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California.
J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28., [PMID:23810505]

Abstract [show]
California uses a unique method to screen newborns for cystic fibrosis (CF) that includes gene scanning and DNA sequencing after only one California-40 cystic fibrosis transmembrane conductance regulator (CFTR) panel mutation has been identified in hypertrypsinogenemic specimens. Newborns found by sequencing to have one or more additional mutations or variants (including novel variants) in the CFTR gene are systematically followed, allowing for prospective assessment of the pathogenic potential of these variants. During the first 3 years of screening, 55 novel variants were identified. Six of these novel variants were discovered in five screen-negative participants and three were identified in multiple unrelated participants. Ten novel variants (c.2554_2555insT, p.F1107L, c.-152G>C, p.L323P, p.L32M, c.2883_2886dupGTCA, c.2349_2350insT, p.K114del, c.-602A>T, and c.2822delT) were associated with a CF phenotype (42% of participants were diagnosed at 4 to 25 months of age), whereas 26 were associated with CFTR-related metabolic syndrome to date. Associations with the remaining novel variants were confounded by the presence of other diseases or other mutations in cis or by inadequate follow-up. These findings have implications for how CF newborn screening and follow-up is conducted and will help guide which genotypes should, and which should not, be considered screen positive for CF in California and elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing. Login to comment
170 Participant 11 was identified with novel variant c.-448A>G in cis with p.A559T and in trans with p.L206W. Login to comment
180 Participants 11, 43, and 44 were all shown to carry novel variant c.-448A>G in cis with known mutation p.A559T. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
79 Six of these variants were specific to African Americans (R75X, G480C, A559T, 2307insA, 3791delC, and S1255X). Login to comment
115 The extended panel detected 21.7% more mutations (P < 0.01) using six additional race-specific (R75X, G480C, A559T, 2307insA, S1255X, and 3791delC) and seven panethnic variants (see Supplementary Table S2 online). Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
357 Moreover, a large ''hot spot`` region for natural CFTR mutations is located at the NBD1:ICL4 interface, involving (1) six ICL4 positions (H1054D, G1061R, L1065P, R1066H/R1066C, F1074L, and L1077P), which line the path followed by F508 during the MD1 conformational transition from its initial to its final position, and (2) seven positions in NBD1 (S492F, I507del, F508del, V520F, A559T, R560K/R560T, and A561E) (Fig. 7c). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment
109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 July 16, 2007 c.164+2T.A (296+2T.A) 28 c.254G.A (G85E) c.274-1G.A (406-1G.A) c.489+1G.T (621+1G.T) c.579+1G.T (711+1G.T) c.595C.T (H199Y) c.933_935delCTT (F311del) c.1000C.T (R334W) c.1519_1521delATC (I507del) c.1521_1523delCTT (F508del) c.1585-1G.A (1717-1G.A) c.1624G.T (G5423) c.1646G.A (S549N) c.1652G.A (G551D) c.1657C.T (R5533) c.1675G.A (A559T) c.1680-1G.A (1812-1G.A) c.1973-1985del13insAGAAA (2105-2117del13insAGAAA) c.2175_2176insA (2307insA) c.2988+1G.A (3120+1G.A) c.3196C.T (R1066C) c.3266G.A (W10893) c.3485G.T (R11623) c.3611G.A (W12043 [3743G.A]) c.3717+12191C.T (3849+10kbC.T) c.3744delA (3876delA) c.3846G.A (W12823) c.3909C.G (N1303K) October 4, 2007 c.1153_1154insAT (1288insTA) 29 December 12, 2007 c.54-5940_273+10250del21kb (CFTRdele2,3(21kb)) 38 c.531delT (663delT) c.613C.T (P205S) c.803delA (935delA) c.1475C.T (S492F) c.1923_1931del9insA (2055del9.A) c.223C.T (R753) c.293A.G (Q98R) c.3140-26A.G (3272-26A.G) August 12, 2008 c.988G.T (G3303) 40 c.3612G.A (W12043 [3744G.A]) c.3659delC (3791delC) c.164+2T.A (296+2T.A), removed cDNA, complementary DNA. Login to comment