ABCMdb

ABCC7 p.Arg560Lys

Admin's notes:	Class II (maturation defect) Veit et al.
ClinVar:	c.1680A>C , p.Arg560Ser ? , not provided c.1679G>A , p.Arg560Lys D , Pathogenic c.1678A>G , p.Arg560Gly ? , not provided c.1679G>C , p.Arg560Thr D , Pathogenic
CF databases:	c.1680A>C , p.Arg560Ser D , CF-causing ; CFTR1: This mutation was identified by DGGE and direct sequencing. c.1679G>C , p.Arg560Thr D , CF-causing c.1679G>A , p.Arg560Lys D , CF-causing ; CFTR1: The nucleotide change was identified once among 87 non-[delta]F508 chromosomes. tTHe patientis a compound heterozygote with 1717-1G->A on the other chromosome. She is 12 years old, with at this time a mild form of the disease. The mutation abolishes a HphI site in exon 11. The mutatee allele is 425 bp and the normal is 211 +214 after hphI digestion but the enzyme digestion identifies both the R560T and R560K. The R560K is a missense mutation and also probably a splice mutation because that position subsitutes AA for AG immediately up stream of the splice acceptor site, postition that has been reported to alter splicing (VIDAUD, PNAS, 86, 1041-1045). c.1678A>G , p.Arg560Gly (CFTR1) ? , This change has been detected by DGGE analysis and direct sequencing. The mutation creates a Mnl I restriction site
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: N (66%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), S: D (59%), T: D (53%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Unilateral renal agenesis associated with congenit... Hum Reprod. 2001 Feb;16(2):282-8. McCallum T, Milunsky J, Munarriz R, Carson R, Sadeghi-Nejad H, Oates R
Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations.
Hum Reprod. 2001 Feb;16(2):282-8., [PMID:11157821]

Abstract [show]
An association between congenital bilateral absence of the vas deferens (CBAVD), normal renal anatomy and cystic fibrosis (CF) gene mutations is well established (CF/CBAVD). We postulate that unilateral renal agenesis (URA) and CBAVD (URA/CBAVD) may have a non-CF mutation-mediated genetic basis that leads to abnormal development of the entire mesonephric duct at a very early stage in embryo development (< or =7 weeks). The physical, laboratory and radiographic findings of men with URA/CBAVD (n = 17) and CF/CBAVD (n = 97) were compared; the fertilization and pregnancy rates in the URA/CBAVD population calculated, and the incidence of renal agenesis in immediate family members and offspring of men with URA/CBAVD analysed. No statistical differences could be identified within any of the above comparisons. The fertilization rate for the URA/CBAVD group was 58.2 +/- 26.3%. Eight infants and two fetuses had normal renal anatomy, while one terminated male fetus had bilateral renal and vasal agenesis. Thirty first-order relatives had normal renal units. Anatomical expression of the reproductive ductal derivatives in men with URA/CBAVD and CF/CBAVD was similar, but the phenotypic outcome of the renal portion of the mesonephric duct was different. The potential for transmission of this fatal anomaly reinforces the need for prenatal ultrasounds with all pregnancies involving URA/CBAVD men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin. Login to comment

[hide] Prevalence of CFTR mutations in hypertrypsinaemia ... Clin Genet. 2001 Jan;59(1):42-7. Scotet V, De Braekeleer M, Audrezet MP, Lode L, Verlingue C, Quere I, Mercier B, Dugueperoux I, Codet JP, Moineau MP, Parent P, Ferec C
Prevalence of CFTR mutations in hypertrypsinaemia detected through neonatal screening for cystic fibrosis.
Clin Genet. 2001 Jan;59(1):42-7., [PMID:11168024]

Abstract [show]
Nowadays, most of the neonatal screening programs for cystic fibrosis (CF) combine the assay of immunoreactive trypsinogen (IRT) with the analysis of the most common mutations of the CFTR gene. The efficiency of this strategy is now well established, but the identification of heterozygotes among neonates with increased IRT is perceived as a drawback. We proposed to assess the heterozygosity frequency among the children with hypertrypsinaemia detected through the CF screening program implemented in Brittany (France) 10 years ago, to describe the CFTR mutations detected in them and to determine the frequency of the IVS8-5T variant. The molecular analysis relies, in our protocol, on the systematic analysis of three exons of the gene (7-10-11). A total of 160,019 babies were screened for CF in western Brittany between 1992 and 1998. Of the 1964 newborns with increased IRT (1.2%), 60 were CF and 213 were carriers. Heterozygosity frequency was 12.8%), i.e. 3 times greater than in the general population (3.9%; p < 10(-6)), Variability of mutations detected in carriers was greater than in CF children (21 mutations versus 10) and a high proportion of mild mutations or variants (A349V, R297Q, R347H, V317A, G544S, R553G, etc) was observed in carriers. The allelic frequency of the 5T (5.6%) was not significantly increased in this cohort. This study is consistent with previous ones in finding a significantly higher rate of heterozygotes than expected among neonates with hypertrypsinaemia. The strategy of screening used here allows to highlight the variability of mutations detected in heterozygotes and to show that severe mutations, as well as mild mutations, have been observed in neonates with hypertrypsinaemia. If there is no doubt that neonatal hypertrypsinaemia is associated with an elevated frequency of carriers, the underlying mechanisms remain obscure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Molecular abnormalities detected in exons 7, 10 and 11 of the CFTR gene in a control population and in the affected and heterozygous children identified by the neonatal screening between 1992 and 1998 in Brittany, France ContributorsAlleles in the controlAlleles in affectedMolecular abnormalities Alleles in carrierExon Type children populationchildren No % No % No % Disease causing mutations Y301C 7 Mild 1 0.47 Constantinou-Deltas CD et al.* 7 Mild 1 1.03 9 4.22 Cremonesi L et al. (38)R347H Audre´zet MP et al. (39)0.471Mild7M348K 7 MildA349V 1 0.47 Audre´zet MP et al. (30) Fe´rec C et al. (29)0.471Mild10S492F 0.942 This studyMild11G544S 11 MildI556V 1 0.47 Ghanem N et al.* R560K 11 Mild 1 0.47 Fe´rec C et al. (29) 1078delT 7 Severe 2 2.06 5 2.35 Claustres M et al. (40) Fe´rec C et al. (29)0.471Severe71221delCT DF508 10 Severe 81 83.51 170 79.81 11 2.6 Kerem B et al. (12) DI507 Schwarz M et al. (41)0.471Severe10 11 Severe1717-1 GA 1 1.03 3 1.41 Kerem B et al. (42) Scotet V et al. (28)1.0311806delA 11 Severe Kerem B et al. (42)1.8743.09G542X 11 Severe 3 5.16 5 2.35 Cutting GR et al. (43)G551D 11 Severe 5 Cutting GR et al. (43)1 0.471.03R553X 11 Severe 1 Non-disease causing mutations R297Q 7 1 1.03 1 0.47 Graham CA et al.* 0.942 This study7V317A V322A 7 1 0.47 This study 11 1 1.03 1 0.47 Scotet V et al. (28)R553G 11R553Q 1 0.47 Dork T et al. (44) 97 100 213 100 422 100 * From Cystic Fibrosis Genetic Analysis Consortium (http://www.genet.sickkids.on.ca) An excess of heterozygotes carrier of the most frequent mutation (DF508) among neonates with hypertrypsinaemia has been reported (23, 24). Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Prenatal detection of cystic fibrosis by ultrasono... J Med Genet. 2002 Jun;39(6):443-8. Scotet V, De Braekeleer M, Audrezet MP, Quere I, Mercier B, Dugueperoux I, Andrieux J, Blayau M, Ferec C
Prenatal detection of cystic fibrosis by ultrasonography: a retrospective study of more than 346 000 pregnancies.
J Med Genet. 2002 Jun;39(6):443-8., [PMID:12070257]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
246 Therefore, the spectrum of mutations identified in this fetal population is not representative of that identified in our CF population, in which we found a significant number of mild mutations or mutations for which the clinical consequences are not yet established (for example, G91R, R117H, R347L, R560K).34 35 These findings provide the foundation for further investigations towards understanding the pathogenesis of early bowel disease, but also why it results in manifestations in the bowel rather than in the lungs during the fetal period. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
34 The mutations in the 25 mutation panel were: ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, 2183AA→G, R117H, ∆I507, R560T, 3849ϩ10kbC→T, S549N, S549I, S549R, R1283M, R1283K, R553G, R560K, R117L, 1774delCT, 1811ϩ1G→C, and 4006-61del14. Login to comment

[hide] Spatial and temporal distribution of cystic fibros... Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1. Scotet V, Gillet D, Dugueperoux I, Audrezet MP, Bellis G, Garnier B, Roussey M, Rault G, Parent P, De Braekeleer M, Ferec C
Spatial and temporal distribution of cystic fibrosis and of its mutations in Brittany, France: a retrospective study from 1960.
Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1., [PMID:12215837]

Abstract [show]
Cystic fibrosis (CF) is the most common severe inherited disorder that affects children in Caucasian populations. The aim of this study was to define the spatial and temporal distribution of CF and its mutations in Brittany (western France) where the frequency of the disease is high. We retrospectively registered all CF patients born in Brittany since 1960 by cross-checking various data sources (e.g. medical care centres, genetics laboratories, hospital archives). Councils were contacted so that the place of residence of patients at birth could be determined. Moreover, the spectrum of CF transmembrane conductance regulator (CFTR) mutations and their spatial distribution across Brittany were determined. A total of 520 patients was registered in this study. The incidence of CF was assessed according to administrative (department, district) and diocesan divisions of Brittany and its evolution analysed over four decades. The incidence of CF was 1/2630, with a west/east gradient that was confirmed over time (Finistere: 1/2071 vs Ille-et-Vilaine: 1/3286). At present, the incidence of CF is decreasing, mainly as a result of prenatal diagnosis. An excellent mutation detection rate of 99.7% was obtained. Western Brittany presented a specific spectrum of mutations: 1078delT (9.4% of mutated alleles in the diocese of Cornouaille), G551D (7.7% in the diocese of Leon), 4005+1G-->A (2.9% in Cornouaille) and W846X (1.5% in western Brittany). On the other hand, the eastern region showed a spectrum more similar to the overall picture in France as a whole. This study enabled a precise measurement of the incidence of CF in Brittany to be obtained. The high frequency of the CFTR mutated alleles may result from founder effects and genetic drifts. Moreover, the study brings together the regional specificities of the CFTR gene and highlights disparities that exist in this part of France, both in incidence and in mutation distribution. These are attributable to different degrees of isolation and of population movements between the eastern and western parts of the region. Given that this is the first time that such a detailed study of the CFTR gene has been performed on a large population, this heightened knowledge of the epidemiology of CF in Brittany should provide a basis for the improvement of diagnostic strategies and refinement of genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 His genotype was ∆F508/∆F508 Mutation Exon Basse-Bretagne Haute-Bretagne Brittanya ∆F508 10 446 75.6% 224 73.7% 672 75.0% 1078delT 7 31 5.3% 3 1.0% 34 3.8% G551D 11 21 3.6% 12 3.9% 33 3.7% N1303K 21 3 0.5% 9 3.0% 12 1.3% W846X 14a 9 1.5% 1 0.3% 10 1.1% 2789+5G→A 14b 3 0.5% 6 2.0% 9 1.0% 1717-1G→A 11 5 0.8% 3 1.0% 8 0.9% Y1092X 17b 1 0.2% 6 2.0% 7 0.8% 4005+1G→A 20 6 1.0% 1 0.3% 7 0.8% E60X 3 3 0.5% 3 1.0% 6 0.7% 621+1G→T 4 3 0.5% 3 1.0% 6 0.7% R347H 7 6 1.0% 0 0.0% 6 0.7% S492F 10 2 0.3% 3 1.0% 5 0.6% G542X 11 4 0.7% 1 0.3% 5 0.6% 3272-26A→G 17b 2 0.3% 3 1.0% 5 0.6% R117H 4 3 0.5% 1 0.3% 4 0.4% G91R 3 3 0.5% 0 0.0% 3 0.3% ∆I507 10 1 0.2% 2 0.7% 3 0.3% R553X 11 3 0.5% 0 0.0% 3 0.3% W1282X 20 2 0.3% 1 0.3% 3 0.3% A72D 3 0 0.0% 2 0.7% 2 0.2% G85E 3 0 0.0% 2 0.7% 2 0.2% F311L 7 0 0.0% 2 0.7% 2 0.2% 1221delCT 7 2 0.3% 0 0.0% 2 0.2% R560K 11 0 0.0% 2 0.7% 2 0.2% 2622+1G→A 13 2 0.3% 0 0.0% 2 0.2% S945L 15 0 0.0% 2 0.7% 2 0.2% I1234V 19 2 0.3% 0 0.0% 2 0.2% G1249R 20 2 0.3% 0 0.0% 2 0.2% 3905insT 20 2 0.3% 0 0.0% 2 0.2% Unidentified - 3 0.5% 0 0.0% 3 0.3% Total - 590 65.7% 304 34.3% 896 100% IVS17bTA, IVS17bCA) of Irish, Scottish, English, Breton and Czech subjects who were carriers of this mutation, and showed that all these alleles carried a unique haplotype (16-7-17), testifying to the Celtic origin of this mutation (Cashman et al. 1995). Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] HFE alleles in an Irish cystic fibrosis population... Genet Test. 2003 Summer;7(2):155-8. Devaney J, Maher M, Smith T, Houghton JA, Glennon M
HFE alleles in an Irish cystic fibrosis population.
Genet Test. 2003 Summer;7(2):155-8., [PMID:12885340]

Abstract [show]
The variable clinical manifestations of cystic fibrosis (CF) suggest the influence of modifier genes. Genetic and environmental factors that determine whether an individual will develop associated complications are still being determined. It has been proposed that the gene for hemochromatosis, HFE, may be a modifier locus for CF disease phenotype. Recent research has suggested a relationship between mutations to the HFE gene and the development of meconium ileus (MI) and liver disease in CF. This study aims to expand our knowledge of the HFE mutations C282Y and H63D carrier rate in an Irish population of CF allele carriers. PCR restriction enzyme analysis was performed on blood samples from CF patients to identify the C282Y and H63D mutations. HFE status of CF allele carriers and CF patients (Delta F508) homozygotes with and without meconium ileus was determined. The carrier frequency for C282Y was 30.8% for the Delta F508 homozygote MI positive group, as compared to 12.5% for the non-Delta F508 MI positive group but did not reach statistical significance (p = 0.27). Interestingly, no Delta F508 homozygote patients were homozygous for the C282Y mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Our non-DF508 CF patients were screened for the R117H, 1717-1G R A, DI507, G542X, G551D, R553X, R560K, and R560T CFTR mutations prior to inclusion in this study; it is interesting to note that the G542X and G551D alleles have positive and negative associations, respectively, with MI development (Schwarz et al., 1995; Feingold and Gailloud-Bataille, 1999). Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Disease-associated nsSNPs at Three Structural Hotspots in Human ABC Transporter NBDs Gene Disease Position ARA motif ABCB11 BRIC2 A570T ABCD1 X-ALD A616V CFTR CF A559T ABCC6 PXE R765Q ABCC8 HHF1 R841G ABCC8 HHF1 R1493Q ABCC8 HHF1 R1493W ABCD1 X-ALD R617C ABCD1 X-ALD R617G ABCD1 X-ALD R617H CFTR CF R560K CFTR CF R560S CFTR CF R560T ABCA1 HDLD1 A1046D ABCB4 ICP A546D C-loop 1 motif ABCC8 HHF1 D1471H ABCC8 HHF1 D1471N CFTR CBAVD G544V ABCC8 HHF1 G1478R C-loop2 motif ABCA4 STGD1 H2128R ABCC8 HHF1 K889T ABCD1 X-ALD R660P ABCD1 X-ALD R660W ABCA1 HDLD2 M1091T ABCA4 STGD1 E2131K ABCA12 LI2 E1539K ABCA4 STGD1 and CORD3 E1122K CFTR CF L610S ABCC8 HHF1 L1543P ABCA1 Colorectal cancer sample; somatic mutation A2109T ABCC9 CMD1O A1513T ABCD1 X-ALD H667D CFTR CF A613T ABCA1 HDLD2 D1099Y ABCD1 X-ALD T668I CFTR CF D614G ABCA4 STGD1 R2139W ABCA4 STGD1 R1129C ABCA4 ARMD2, STGD1, and FFM R1129L Disease abbreviations are as follows: BRIC2, benign recurrent intrahepatic cholestasis type 2; X-ALD, X-linked adrenoleukodystrophy; CF, cystic fibrosis; PXE, Pseudoxanthoma elasticum; HHF1, familial hyperinsulinemic hypoglycemia-1; HDLD1, high density lipoprotein deficiency type 1; ICP, intrahepatic cholestasis of pregnancy; CBAVD, congenital bilateral absence of the vas deferens; STGD1, Stargardt disease type 1; HDLD2, high density lipoprotein deficiency type 2; LI2, ichthyosis lamellar type 2; CORD3, cone-rod dystrophy type 3; CMD1O, cardiomyopathy dilated type 1O; ARMD2, age-related macular degeneration type 2; FFM, fundus flavimaculatus. Login to comment

[hide] Newborn screening for cystic fibrosis: Polish 4 ye... Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180. Sobczynska-Tomaszewska A, Oltarzewski M, Czerska K, Wertheim-Tysarowska K, Sands D, Walkowiak J, Bal J, Mazurczak T
Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.
Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180., [PMID:22892530]

Abstract [show]
Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1 212 487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.European Journal of Human Genetics advance online publication, 15 August 2012; doi:10.1038/ejhg.2012.180.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 e M1V, R75X, L165S, F311L, R560K, 1898+1G>C, 1949del84, 2113delA, 2184delA, R792X, W846X2, 3121-1G>A, H1054D, 3737delA, D1270N+R74W. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment
135 Effect of Amplicon Size on Mutation Detection Rate in ABCC7 Exon 11 SSCP slab gels SSCP 310 DHPLC 49:1, 20°C MDE, 20°C 35°C Exon 11 ABCC7 190bp 490bp 190bp 490bp 190bp 490bp 190bp 490bp 1717-1G>A - - + + + + + + G542X + + + + + - + + S549N + + + + + + - - S549R + + - + + + + - G551D - + + + - - + - R553X + + + + + + + - G551D/R553X + + + + + + + - R560T + - - + - - + + R560K + + + + - - + + 1811+1G>C + + + + + + + + Sensitivity 9/10 8/10 8/10 10/10 7/10 6/10 9/10 5/10 ammonium acetate as an ion-pairing agent has the unintended consequence of modifying the stability of GC and AT base pairs in a similar manner to the effects of tetra-alkyl ammonium salts, tetraethyl ammonium chloride and tetramenthyl ammonium chloride. Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d. Login to comment

[hide] Neonatal screening for cystic fibrosis: result of ... Hum Genet. 1995 Nov;96(5):542-8. Ferec C, Verlingue C, Parent P, Morin JF, Codet JP, Rault G, Dagorne M, Lemoigne A, Journel H, Roussey M, et al.
Neonatal screening for cystic fibrosis: result of a pilot study using both immunoreactive trypsinogen and cystic fibrosis gene mutation analyses.
Hum Genet. 1995 Nov;96(5):542-8., [PMID:8530001]

Abstract [show]
We have evaluated a two-tier neonatal cystic fibrosis (CF) screening of immunoreactive trypsinogen (IRT) followed by CFTR gene mutation analysis using a systematic scanning of exons 7, 10, and 11, and, if necessary, by direct DNA sequencing. Over an 18-month period we screened 32,300 neonates born in the western part of Britanny. The first tier, involving IRT screening at 3 days of age, utilizes a low elevation of the trypsinogen level (600 ng/ml), which is highly sensitive. The second tier, which corresponds to the exhaustive screening for mutations in three exons of the gene, is highly specific for this population (Britanny). The false positive rate is very low, and no false negatives have been reported to date. This strategy has allowed the identification of five novel alleles (V322A, V317A, 1806 del A, R553G, G544S).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 {17bi DI507 [ Y569X W846X 2789+5G->A ,' $492F i ] i I G551D 2622+1 G->A Y1092X 1717-1 G->A E827X A1067T G542X 2183 AA->G R1066H R560K 2184 ins A 3320,ins 5 R553G R1070W 1806 del A & 4005+1G->A W1282X ] i "- Exons Fig.2 Distribution of the different mutations (except AF508) of the CFTR gene in Brittany Table 1 Mutations and genotypes in newborns Genotypes of newborns Number Sweat test AF508/AF508 7 + > 90 AF508/1806 del A 1 + > 90 R553G/G551D 1 Borderline (60) AF508/G551D 1 + > 90 AF508/R1070W 1 40 AF508/G542X 1 + > 90 AF508/G149R 1 45 Total 13 Mutations found in heterozygote newborns AF508 31 R560K 1 1078 del T 1 G544S l G542X 1 V317A 1 R347H 1 V322A 1 Total 38 gene. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 (G-A at 1807), R560K (G-A at 1811) and mutations L719X (T-A), 2522insC, 2556insAT, E827X on exons 11 and 13, respectively, for all except one analysis condition (see Table 1). Login to comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
357 Moreover, a large ''hot spot`` region for natural CFTR mutations is located at the NBD1:ICL4 interface, involving (1) six ICL4 positions (H1054D, G1061R, L1065P, R1066H/R1066C, F1074L, and L1077P), which line the path followed by F508 during the MD1 conformational transition from its initial to its final position, and (2) seven positions in NBD1 (S492F, I507del, F508del, V520F, A559T, R560K/R560T, and A561E) (Fig. 7c). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment