ABCMdb

ABCC7 p.Ile507Val

ClinVar:	c.1519A>G , p.Ile507Val N , Likely benign
CF databases:	c.1519_1521delATC , p.Ile507del D , CF-causing c.1521C>G , p.Ile507Met (CFTR1) ? ,
Predicted by SNAP2:	A: D (85%), C: D (75%), D: D (91%), E: D (95%), F: D (91%), G: D (95%), H: D (95%), K: D (95%), L: N (66%), M: D (66%), N: D (91%), P: D (95%), Q: D (91%), R: D (95%), S: D (91%), T: D (91%), V: N (93%), W: D (95%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mutation in the gene responsible for cystic fibros... JAMA. 2000 Oct 11;284(14):1814-9. Wang X, Moylan B, Leopold DA, Kim J, Rubenstein RC, Togias A, Proud D, Zeitlin PL, Cutting GR
Mutation in the gene responsible for cystic fibrosis and predisposition to chronic rhinosinusitis in the general population.
JAMA. 2000 Oct 11;284(14):1814-9., 2000-10-11 [PMID:11025834]

Abstract [show]
CONTEXT: Chronic rhinosinusitis (CRS) is a common condition in the US general population, yet little is known about its underlying molecular cause. Chronic rhinosinusitis is a consistent feature of the autosomal recessive disorder cystic fibrosis (CF). OBJECTIVE: To determine whether mutations in the cystic fibrosis transmembrane regulator (CFTR) gene, which is responsible for CF, predispose to CRS. DESIGN: Case-control study conducted from 1996 to 1999 in which the DNA of CRS patients and controls was typed for 16 mutations that account for 85% of CF alleles in the general population. Chronic rhinosinusitis patients with 1 CF mutation were evaluated for a CF diagnosis by sweat chloride testing, nasal potential difference measurement, and DNA analysis for additional mutations. SETTING: Otolaryngology-head and neck clinic of a US teaching hospital. PARTICIPANTS: One hundred forty-seven consecutive adult white patients who met stringent diagnostic criteria for CRS and 123 CRS-free white control volunteers of similar age range, geographic region, and socioeconomic status. MAIN OUTCOME MEASURES: Presence of CF mutations by DNA analysis among CRS patients vs controls. RESULTS: Eleven CRS patients were found to have a CF mutation (DeltaF508, n = 9; G542X, n = 1; and N1303K, n = 1). Diagnostic testing excluded CF in 10 of these patients and led to CF diagnosis in 1. Excluding this patient from the analyses, the proportion of CRS patients who were found to have a CF mutation (7%) was significantly higher than in the control group (n = 2 [2%]; P =.04, both having DeltaF508 mutations). Furthermore, 9 of the 10 CF carriers had the polymorphism M470V, and M470V homozygotes were overrepresented in the remaining 136 CRS patients (P =.03). CONCLUSION: These data indicate that mutations in the gene responsible for CF may be associated with the development of CRS in the general population. JAMA. 2000;284:1814-1819.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Analysis of CFTR Genes Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621+1G→T, R334W, R347P, A455E, ⌬I507, ⌬F508, 1717-1 G→A, G542X, S549N, G551D, R553X, R560T, 3849+10 Kb C→T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16,17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 The 86-mutation assay distinguished ⌬F508 from the F508C, I506V, I506M, and I507V sequence variants. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Clin Exp Allergy. 2002 May;32(5):756-61. Eaton TE, Weiner Miller P, Garrett JE, Cutting GR
Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?
Clin Exp Allergy. 2002 May;32(5):756-61., [PMID:11994102]

Abstract [show]
BACKGROUND: Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). OBJECTIVE: To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. METHODS: Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. RESULTS: Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. CONCLUSION: These results lend further support to a possible link between CF mutations and ABPA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Patients were also screened for CFTR variants in intron 8 (5T, 7T and 9T) and polymorphisms F508C, I506V and I507V. Login to comment

[hide] Development and evaluation of a PCR-based, line pr... Clin Chem. 2002 Jul;48(7):1121-3. Wang X, Myers A, Saiki RK, Cutting GR
Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Clin Chem. 2002 Jul;48(7):1121-3., [PMID:12089190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Amplicon Size, bp Mutations (polymorphisms) Exon 13 598 2307 insA Intron 8, exon 09 548 A455E, 5T (7/9 T polymorphism) Exon 10 482 G480C, ⌬I507, ⌬F508 (F508C, I507V, I506V polymorphisms) Intron 10, exon 11 433 1717-1G3A, G542X, G551D, R553X, A559T, R560T Exon 19 420 R1162X, 3659delC Exon 21 397 N1303K Exon 20 359 S1255X, W1282X Exon 07 328 1078delT, R334W, R347P Exon 04, intron 4 288 R117H, 621ϩ1G3T Intron 14b 248 2789ϩ5G3A Intron 19 237 3849ϩ10kbC3T Exon 03 210 G85E, 405ϩ3A3C Intron 5 166 711ϩ1G3T Intron 16 139 3120ϩ1G3A Clinical Chemistry 48, No. Login to comment
88 The genotypes of each sample are as follows: lane 1, ϩ/ϩ (ϩ is the wild type); lane 2, 5T, R117H/3659delC; lane 3, G542X/ϩ; lane 4, I506V/ϩ; lane 5, I507V/ϩ; lane 6, F508C/⌬F508; lane 7, G85E/⌬F508; lane 8, 405ϩ3A3C/3120ϩ1G3C; lane 9, R117H/ϩ; lane 10, 621ϩ1G3T/⌬F508; lane 11, 711ϩ1G3T/⌬F508; lane 12, 1078delT/ϩ; lane 13, R334W/⌬F508; lane 14, R347P/⌬F508; lane 15, A455E/ϩ; lane 16, G480C/⌬F508; lane 17, ⌬I507/ϩ; lane 18, ⌬F508/ϩ; lane 19, 1717-1G3A/ϩ; lane 20, G542X/ϩ; lane 21, G551D/⌬F508; lane 22, R553X/ϩ; lane 23, R560T/⌬F508; lane 24, G551D/A559T; lane 25, 2307insA/ϩ; lane 26, 2789ϩ5G3A/⌬F508; lane 27, 3120ϩ1G3A/⌬F508; lane 28, R1162X/R1162X; lane 29, 3659delC/⌬F508; lane 30, 3849ϩ10kbC3T/⌬F508; lane 31, S1255X/⌬F508; lane 32, W1282X/G542X; lane 33, N1303K/ϩ. Login to comment
98 On the other hand, the ⌬F508 mutation is the most common CF allele, and three polymorphisms (I506V, I507V, and F508C) can interfere with hybridization of the wild-type oligonucleotide sequence. Login to comment
99 Thus, the presence of oligonucleotides corresponding to the three polymorphisms in the Research Prototype Cystic Fibrosis Assay-31 test avoids misdiagnosis of ⌬F508/I506V, I507V, or F508C compound heterozygotes. Login to comment

[hide] Survey of CF mutations in the clinical laboratory. BMC Clin Pathol. 2002 Nov 19;2(1):4. Huber K, Mirkovic B, Nersesian R, Myers A, Saiki R, Bauer K
Survey of CF mutations in the clinical laboratory.
BMC Clin Pathol. 2002 Nov 19;2(1):4., 2002-11-19 [PMID:12437773]

Abstract [show]
BACKGROUND: Since it is impossible to sequence the complete CFTR gene routinely, clinical laboratories must rely on test systems that screen for a panel of the most frequent mutations causing disease in a high percentage of patients. Thus, in a cohort of 257 persons that were referred to our laboratory for analysis of CF gene mutations, reverse line probe assays for the most common CF mutations were performed. These techniques were evaluated as routine first-line analyses of the CFTR gene status. METHODS: DNA from whole blood specimens was extracted and subjected to PCR amplification of 9 exons and 6 introns of the CFTR gene. The resulting amplicons were hybridised to probes for CF mutations and polymorphisms, immobilised on membranes supplied by Roche Molecular Systems, Inc. and Innogenetics, Inc. Denaturing gradient gel electrophoresis and sequencing of suspicious fragments indicating mutations were done with CF exon and intron specific primers. RESULTS: Of the 257 persons tested over the last three years (referrals based on 1) clinical symptoms typical for/indicative of CF, 2) indication for in vitro fertilisation, and 3) gene status determination because of anticipated parenthood and partners or relatives affected by CF), the reverse line blots detected heterozygote or homozygote mutations in the CFTR gene in 68 persons (26%). Eighty-three percent of those affected were heterozygous (47 persons) or homozygous (10 persons) for the DeltaF508 allele. The only other CF-alleles that we found with these tests were the G542X allele (3 persons), the G551D allele (3 persons), the 3849+10kb C-T allele (2 persons) the R117H allele (2 persons) and the 621+1G-T allele (1 person).Of the fifteen IVS8-5T-polymorphisms detected in intron 8, seven (47%) were found in males referred to us from IVF clinics. These seven 5T-alleles were all coupled with a heterozygous DeltaF508 allele, they make up 35% of the males with fertility problems (20 men) referred to us. CONCLUSIONS: In summary, the frequency of CF chromosomes in the cohort examined with these tests was 26%, with the DeltaF508 allele affecting 83% of the CF chromosomes. It is a substantial improvement for routine CF diagnostics to have available a test system for 30 mutations plus the polypyrimidine length variants in intron 8. Our results show that this test system allows a routine first-line analyses of the CFTR gene status.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 F508C, I507V, I506V polymorphism exon 11 1717-1G → A, G542X, S549N, G551D, R553X, R560T exon 20 W1282X exon 21 N1303K intron 19 3849+10kb C → T Innogenetics assay: exon 3 394delTT, G85E, E60X exon/intron 4 621+1G-T, R117H exon 7 1078delT, R347P, R334W exon 13 2143delT, 2183AA-G, 2184delA exon 19 R1162X, 3659delC intron 5 711+5G-A intron8/exon 9 A455E,, 5T,7T,9T intron 14b 2789+5G-A intron 19 3849+10kb C-T Table 2: Genotypes of patients with mutations, final results Group 1) (patients with symptoms typical for/indicative of CF) No. Login to comment

[hide] Direct visualization of cystic fibrosis transmembr... Clin Chem. 2004 May;50(5):836-45. Epub 2004 Mar 9. Strom CM, Clark DD, Hantash FM, Rea L, Anderson B, Maul D, Huang D, Traul D, Chen Tubman C, Garcia R, Hess PP, Wang H, Crossley B, Woodruff E, Chen R, Killeen M, Sun W, Beer J, Avens H, Polisky B, Jenison RD
Direct visualization of cystic fibrosis transmembrane regulator mutations in the clinical laboratory setting.
Clin Chem. 2004 May;50(5):836-45. Epub 2004 Mar 9., [PMID:15010427]

Abstract [show]
BACKGROUND: The recommendation for population- based cystic fibrosis (CF) carrier screening by the American College of Medical Genetics for the 25 most prevalent mutations and 6 polymorphisms in the CF transmembrane regulatory gene has greatly increased clinical laboratory test volumes. We describe the development and technical validation of a DNA chip in a 96-well format to allow for high-throughput genotype analysis. METHODS: The CF Portrait chip contains an 8 x 8 array of capture probes and controls to detect all requisite alleles. Single-tube multiplex PCR with 15 biotin-labeled primer pairs was used to amplify sequences containing all single-nucleotide polymorphisms to be interrogated. Detection of a thin-film signal created by hybridization of multiplex PCR-amplified DNA to complementary capture probes was performed with an automated image analysis instrument, NucleoSight. Allele classification, data formatting, and uploading to a laboratory information system were fully automated. RESULTS: The described platform correctly classified all mutations and polymorphisms and can screen approximately 1300 patient samples in a 10-h shift. Final validation was performed by two separate 1000-sample comparisons with Roche CF Gold line probe strips and the Applera CF OLA, Ver 3.0. The CF Portrait Biochip made no errors during this validation, whereas the Applera assay made seven miscalls of the IVS-8 5T/7T/9T polymorphism CONCLUSIONS: The CF Portrait platform is an automated, high-throughput, DNA chip-based assay capable of accurately classifying all CF mutations in the recommended screening panel, including the IVS-8 5T/7T/9T polymorphism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
184 For example, wild-type probes for I506V and I507V share common sequences with the ⌬F508 probe, and ⌬I507 and F508C have identical wild-type sequence (see Table 2 in the online Data Supplement); this is not surprising because they detect mutations on three contiguous codons. Login to comment
185 As a consequence, when the ⌬F508/⌬F508 homozygous mutant sample was tested the F508C, ⌬I507, I506V, and I507V wild-type probes all lost activity, and in the case of the I506V/⌬F508 compound heterozygote, the I507V wild-type probe lost activity. Login to comment
199 In this series, there were 17 ⌬F508 heterozygous patient samples, 1 ⌬F508 homozygous sample, 2 R117H heterozygous samples, and 1 heterozygous patient sample each for I148T, G542X, R553X, R347P, and 2789 ϩ 5GϾA, for a total of 26 mutant alleles. Additional mutant alleles detected in the control samples included three fixed control samples (⌬F508 homozygous, 5T/WT, 3659delC/⌬F508) on every plate and two heterozygous samples (R560T and 1078delT) and one heterozygous sample each for R334W, A455E, R347P, R117H, ⌬I507, I507V, G551D, and 1717-1GϾA as rotating controls. Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 DNA Amplification and colorimetric detection on linear array strips with Analyte Specific Reagents for a 16-mutation assay (gift from Roche Molecular Systems, Alameda, CA) and a 27-mutation assay (Linear Array CF-31; Roche Molecular Biochemicals, Indianapolis, IN) were used.20 For both panels, the DNA assay assessed only CFTR mutations; detection of polymorphisms was incorporated as a reflex test for confirmation of putative ⌬F508 homozygotes (assay for F508C, I506V, and I507V) or for genotype elucidation on detection of 2 mutations including R117H (assay for IVS8polyT 5/7/9T). Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Cystic fibrosis carrier screening: validation of a... Genet Med. 2004 Sep-Oct;6(5):431-8. Edelmann L, Hashmi G, Song Y, Han Y, Kornreich R, Desnick RJ
Cystic fibrosis carrier screening: validation of a novel method using BeadChip technology.
Genet Med. 2004 Sep-Oct;6(5):431-8., [PMID:15371909]

Abstract [show]
PURPOSE: To validate a novel BeadChip assay system for cystic fibrosis (CF) mutation testing using the panel of 25 ACMG recommended mutations and D1152H. METHODS: DNA from 519 individuals originally tested for CF mutation status by allele specific oligonucleotide hybridization (ASOH) were blindly analyzed by the BeadChip assay and the results were compared. The elongation mediated multiplexed analysis of polymorphisms (eMAP) protocol, which combines multiplex amplification of genomic DNA and multiplex detection of mutations on color-coded bead arrays, was used to analyze 26 CF mutations in two separate groups. RESULTS: The system accurately distinguished the 26 CF genotypes and had 100% concordance with the ASOH technique with an assay failure rate of 1.7%. Benign variants of exon 10 codons 506, 507, and 508 did not interfere with mutation identification and reflex testing for the 5/7/9T IVS8 polymorphism was performed on a separate array. CONCLUSIONS: The BeadChip assay system provided accurate and rapid identification of the ACMG recommended CF mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Key Words: cystic fibrosis, carrier screening, BeadChip technology Cystic fibrosis (CF) results from mutations in the CF transmembrane conductance regulator (CFTR) and is a common autosomal recessive disorder, particularly in individuals of Caucasian and Ashkenazi Jewish (AJ) ancestry.1,2 CF also affects individuals from other ethnic groups, including Hispanics, African Americans, and Asians with carrier frequencies ranging from 1in46to1in90.1 Morethan1000mutationshavebeendescribed in the CFTR gene and although many of them are private mutations, there are a number of mutations that are distributed worldwide and still others that are common to specific ethnic groups.3 In2001,theAmericanCollegesofMedicalGenetics(ACMG)and Obstetrics and Gynecologists (ACOG) established guidelines for prenatal carrier testing for CF that included a panel of 25 panethnic mutations with allele frequencies Ն 0.1% among CF patients inNorthAmerica.1,4 Inaddition,theyrecommendedthatcarriers of R117H be subsequently tested for the 5/7/9T polymorphic alleles in intron 8 and that individuals positive for delF508 and delI507 have reflex testing for interference from the benign variants F508C, I506V, and I507V.1 The ACMG/ACOG recommendations precipitated a dramatic increase in the number of CF tests performed in genetic testing laboratories. Login to comment

[hide] Lack of association of common cystic fibrosis tran... Am J Gastroenterol. 2005 Apr;100(4):874-8. Gallegos-Orozco JF, E Yurk C, Wang N, Rakela J, Charlton MR, Cutting GR, Balan V
Lack of association of common cystic fibrosis transmembrane conductance regulator gene mutations with primary sclerosing cholangitis.
Am J Gastroenterol. 2005 Apr;100(4):874-8., [PMID:15784035]

Abstract [show]
BACKGROUND: Primary sclerosing cholangitis (PSC) is a chronic progressive cholestatic liver disease of uncertain etiology. However, the histologic features of PSC liver disease can resemble those in cystic fibrosis (CF), an inherited disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. We sought to determine if PSC patients have a higher frequency of common CF alleles than disease controls. METHODS: DNA was extracted from peripheral lymphocytes of patients with end-stage liver disease. Samples were obtained before liver transplantation from 59 PSC patients and from three groups of control patients (20 each with primary biliary cirrhosis, autoimmune hepatitis, or hepatitis C). DNA samples were genotyped for 32 common CF mutations, the intron 8 T tract variants, and the M470V variant. RESULTS: One of 59 PSC patients (1.7%) had the common CF mutation (DeltaF508) in one CFTR gene. Two controls (3.3%) carried a single CF mutation (DeltaF508 in one primary biliary cirrhosis patient; W1282X in one hepatitis C patient). These rates do not differ from expected in the general population. The frequency of CFTR variants (5T and M470V) was also similar between PSC patients and controls. CONCLUSIONS: Despite anatomical similarities between CF liver disease and PSC, we could not confirm that PSC patients carried common CF mutations or common CFTR variants in higher than expected frequencies. These data suggest that CFTR dysfunction does not influence the pathogenesis of PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 CFTR Mutations and Associated Phenotype Classic Nonclassic Cystic Fibrosis Cystic Fibrosis Variant Normal 621 + 1G→T R117H G85E* 7T 711 + 1G→T R334W 5T† 9T 1078delT R347P M470V‡ F508C I507 A455E I507V F508 2789 + 5G → A I506V 1717 - 1G→A 3849 + 10kbC→T G542X G551D R553X R560T R1162X 3659delC W1282X N1303K * Classic cystic fibrosis and nonclassic cystic fibrosis. Login to comment

[hide] Time-motion analysis of 6 cystic fibrosis mutation... Clin Chem. 2005 Jul;51(7):1116-22. Epub 2005 Apr 28. Krafft AE, Lichy JH
Time-motion analysis of 6 cystic fibrosis mutation detection systems.
Clin Chem. 2005 Jul;51(7):1116-22. Epub 2005 Apr 28., [PMID:15860566]

Abstract [show]
BACKGROUND: A dramatic increase in requests for routine cystic fibrosis (CF) carrier screening prompted us to conduct a time-motion analysis comparing commercially available CF testing platforms. Questions addressed in the study included: (a) How much time is required to perform each step involved in carrying out the assay procedure? (b) Which system requires the minimum number of manual manipulations to complete a typical run? (c) What workflow benefits can be achieved by automation? METHODS: We used a 96-sample run for comparisons and analyzed each of the 6 methods to determine the number of pipetting steps and manual manipulations, the labor and instrument time, and the total time required to perform the assay. The survey participants included a staff of 4 technologists who perform complex molecular assays regularly. Time required for each procedure was determined by direct observation and from work logs completed by the technologists. RESULTS: The total number of pipetting motions varied from 78 to 344. Labor time ranged from 2.6 to 8.4 h, and total assay time from 7.6 to 13.7 h. CONCLUSION: Time-motion analysis allowed identification of a method that minimized pipetting motions and thus reduced the risk of repetitive stress injury.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 CFTR mutation detection system OLA, Ver. 3 INNO-LiPA CF Gold 1.0 Tag-It CF 40 ؉ 4 CF eMAP/ Bead Chip Invader Source Abbott (ABI/ Celera) Innogenetics Roche TM Biosciences BioArray Solutions Third Wave Assay type OLA Reverse slot-blot ASOa Reverse slot-blot ASO ASPE ASPE Invader technology Enzymatic reactions (n) Multiplex PCR (1); OLA (1) Multiplex PCR (2); SA-HRP (1) Multiplex PCR (1); SA-HRP (1) Multiplex PCR (1); Exo-SAP (1); ASPE (1) Multiplex PCR (1); Exo-SAP (2); ASPE (1) Cleavase (6) Special equipment ABI 3100 capillary electrophoresis Auto-LiPA I Gemini Twin shaking water bath Luminex 100 Array imaging system Tecan GENios plate reader Additional Mutations 7 11 6 16 12 Polymorphisms 5/7/9T 5/7/9T 5/7/9T Reflex tests required 5/7/9T Yes Nob Nob Nob Yes Yes I506V/I507V Yes Noc No No No Yes Automated allele calling Yes No No Yes Yes No a ASO, allele-specific oligonucleotides; SA-HRP, streptavidin-conjugated horseradish peroxidase; Exo-SAP, exonuclease plus shrimp alkaline phosphatase digestion. Login to comment

[hide] A novel computational and structural analysis of n... Genomic Med. 2008 Jan;2(1-2):23-32. Epub 2008 May 14. George Priya Doss C, Rajasekaran R, Sudandiradoss C, Ramanathan K, Purohit R, Sethumadhavan R
A novel computational and structural analysis of nsSNPs in CFTR gene.
Genomic Med. 2008 Jan;2(1-2):23-32. Epub 2008 May 14., [PMID:18716917]

Abstract [show]
Single Nucleotide Polymorphisms (SNPs) are being intensively studied to understand the biological basis of complex traits and diseases. The Genetics of human phenotype variation could be understood by knowing the functions of SNPs. In this study using computational methods, we analyzed the genetic variations that can alter the expression and function of the CFTR gene responsible candidate for causing cystic fibrosis. We applied an evolutionary perspective to screen the SNPs using a sequence homology-based SIFT tool, which suggested that 17 nsSNPs (44%) were found to be deleterious. The structure-based approach PolyPhen server suggested that 26 nsSNPS (66%) may disrupt protein function and structure. The PupaSuite tool predicted the phenotypic effect of SNPs on the structure and function of the affected protein. Structure analysis was carried out with the major mutation that occurred in the native protein coded by CFTR gene, and which is at amino acid position F508C for nsSNP with id (rs1800093). The amino acid residues in the native and mutant modeled protein were further analyzed for solvent accessibility, secondary structure and stabilizing residues to check the stability of the proteins. The SNPs were further subjected to iHAP analysis to identify htSNPs, and we report potential candidates for future studies on CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 The nsSNPs which were predicted to be Table 1 List of nsSNPs that were predicted to be deleterious by SIFT and PolyPhen SNPs ID Alleles AA change Tolerance index PSIC rs1800072 G/A V11C 1.00 0.150 rs1800073 C/T R31C 0.18 2.288 rs1800074 A/T D44V 0.01 2.532 rs1800076 G/A R75Q 0.03 1.754 rs1800078 T/C L138P 0.01 2.192 rs35516286 T/C I148T 0.41 1.743 rs1800079 G/A R170H 0.05 1.968 rs1800080 A/G S182G 0.03 1.699 rs1800086 C/G T351S 0.30 1.600 rs1800087 A/C Q353H 0.03 2.093 rs4727853 C/A N417K 1.00 0.015 rs11531593 C/A F433L 0.65 0.694 rs1800089 C/T L467F 0.15 1.568 rs213950 G/A V470M 0.17 1.432 rs1800092 C/A/G I506M 0.00 1.574 rs1801178 A/G I507V 0.38 0.314 rs1800093 T/G F508C 0.00 3.031 rs35032490 A/G K532E 1.00 1.525 rs1800097 G/A V562I 0.13 0.345 rs41290377 G/C G576A 0.33 1.262 rs766874 C/T S605F 0.03 2.147 rs1800099 A/G S654G 0.03 1.611 rs1800100 C/T R668C 0.01 2.654 rs1800101 T/C F693L 0.61 0.895 rs1800103 A/G I807M 0.01 1.554 rs1800106 T/C Y903H 0.52 0.183 rs1800107 G/T S909I 0.10 1.624 rs1800110 T/C L967S 0.07 1.683 rs1800111 G/C L997F 0.24 1.000 rs1800112 T/C I1027T 0.03 1.860 rs1800114 C/T A1067V 0.04 1.542 rs36210737 T/A M1101K 0.05 2.637 rs35813506 G/A R1102K 0.52 1.589 rs1800120 G/T R1162L 0.00 2.038 rs1800123 C/T T1220I 0.22 0.059 rs34911792 T/G S1235R 0.45 1.483 rs11971167 G/A D1270N 0.12 1.739 rs4148725 C/T R1453W 0.00 2.513 Highly deleterious by SIFT and damaging by PolyPhen are indicated as bold deleterious in causing an effect in the structure and function of the protein by SIFT, PolyPhen and Pupasuite correlated well with experimental studies (Tsui 1992; Ghanem et al. 1994; Bienvenu et al. 1998) (Table 3). Login to comment

[hide] A novel approach to CFTR mutation testing by pyros... Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16. Bickmann JK, Kamin W, Wiebel M, Hauser F, Wenzel JJ, Neukirch C, Stuhrmann M, Lackner KJ, Rossmann H
A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities.
Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16., [PMID:19372188]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a common autosomal recessive genetic disorder caused by a variety of sequence alterations in the CFTR gene [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)]. Because the relative prevalence of mutations strongly depends on the ethnic background, first-level testing of CF as defined by recent consensus recommendations ought to be adaptable to the ethnicity of patients. METHODS: We therefore developed and implemented a diagnostic approach to first-level testing for CF based on published mutation frequencies and Pyrosequencing (PSQ) technology that we complemented with standard procedures of mutation detection at the second level. RESULTS: The current test system of PSQ assays for 46 target CF mutations [including CFTRdele2,3 (21 kb) and 1342-6 (T)(n) (5T/7T/9T)] permits recombinations of single assays to optimize sensitivities for certain ethnicities. By easy expansion of the original mutation panel, the first-level test sensitivities with other ethnic groups would be increased, provided that the mutation frequencies are known. The test was validated with our local, ethnically mixed, but mainly German population (155 patients). The mutation-detection rate for the 92 patients whose CF was confirmed by the sweat test was 89.0% for the patients of German descent (73 of the 92 patients) and 73.7% for the patients of any other origin (19 of the 92 patients). Ethnicity-adapted testing panels for our foreign CF patients would increase the sensitivities for the respective groups by approximately 5%. CONCLUSIONS: PSQ-based genotyping is a reliable, convenient, highly flexible, and inexpensive alternative to conventional methods for first-level testing of CFTR, facilitating flexible adaptation of the analyzed mutation panel to any local ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 Furthermore, the PSQ-based first-level test avoids common pitfalls, as do the most recent assays: It correctly discriminates G551D and R553X, as well as I507del and F508del (Fig. 3; see Fig. 1 in the online Data Supplement), thus obviating reflex testing for benign sequence variations such as I506V, I507V, and F508C. Login to comment
148 Fig. 2 in the online Data Supplement illustrates the capability of the assay to discriminate I507del, F508del, 1677delTA, and the interfering benign variants I506V, I507V, and F508C. Login to comment

[hide] Impact of gene patents and licensing practices on ... Genet Med. 2010 Apr;12(4 Suppl):S194-211. Chandrasekharan S, Heaney C, James T, Conover C, Cook-Deegan R
Impact of gene patents and licensing practices on access to genetic testing for cystic fibrosis.
Genet Med. 2010 Apr;12(4 Suppl):S194-211., [PMID:20393308]

Abstract [show]
Cystic fibrosis is one of the most commonly tested autosomal recessive disorders in the United States. Clinical cystic fibrosis is associated with mutations in the CFTR gene, of which the most common mutation among Caucasians, DeltaF508, was identified in 1989. The University of Michigan, Johns Hopkins University, and the Hospital for Sick Children, where much of the initial research occurred, hold key patents on cystic fibrosis genetic sequences, mutations, and methods for detecting them. Several patents, including the one that covers detection of the DeltaF508 mutation, are jointly held by the University of Michigan and the Hospital for Sick Children in Toronto, with Michigan administering patent licensing in the United States. The University of Michigan broadly licenses the DeltaF508 patent for genetic testing with >60 providers of genetic testing to date. Genetic testing is now used in newborn screening, diagnosis, and for carrier screening. Interviews with key researchers and intellectual property managers, a survey of laboratories' prices for cystic fibrosis genetic testing, a review of literature on cystic fibrosis tests' cost-effectiveness, and a review of the developing market for cystic fibrosis testing provide no evidence that patents have significantly hindered access to genetic tests for cystic fibrosis or prevented financially cost-effective screening. Current licensing practices for cystic fibrosis genetic testing seem to facilitate both academic research and commercial testing. More than 1000 different CFTR mutations have been identified, and research continues to determine their clinical significance. Patents have been nonexclusively licensed for diagnostic use and have been variably licensed for gene transfer and other therapeutic applications. The Cystic Fibrosis Foundation has been engaged in licensing decisions, making cystic fibrosis a model of collaborative and cooperative patenting and licensing practice.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
184 I506V, I507V, and F508C are performed only as reflex tests for unexpected homozygosity for ⌬F508 and/or ⌬I507. Login to comment

[hide] An update on cystic fibrosis screening. Clin Lab Med. 2010 Sep;30(3):533-43. Goetzinger KR, Cahill AG
An update on cystic fibrosis screening.
Clin Lab Med. 2010 Sep;30(3):533-43., [PMID:20638569]

Abstract [show]
Cystic fibrosis (CF) is a monogenic, autosomal recessive disorder, which ultimately leads to multisystem organ dysfunction and a subsequent decrease in life expectancy. Because of the sizeable number of disease causing mutations (>1000) and expansive ethnic and racial distribution, CF has presented a challenge for prenatal diagnosis. This article aims to review the genetics of CF, its spectrum of genotypic-phenotypic variations, current prenatal carrier screening and diagnostic recommendations, ultrasonographic markers of CF, and available reproductive options for carrier couples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Given that 5% of the general population will test positive for the 5T polymorphism alone, this test is recommended only as a reflex to a positive R117H result.22,23 Non CF-causing variants, including I506V, I507V, and F508C, can mistakenly cause a false-positive result based on laboratory and testing methodologies. Login to comment
54 For example, in patients who screen positive for DF508 carrier status and for one of the aforementioned mutations, a false-positive test for DF508 homozygosity may be obtained, although the patient is an otherwise healthy individual.22 Although F508C has been associated with CBAVD, neither I506V nor I507V have been associated with any phenotypic manifestations of classical CF or CBAVD.24 Therefore, reflex testing for I506V, I507V, and F508C should be performed in any healthy individual who tests positive for DF508 or DI507 homozygosity, but these mutations should not be otherwise used for a priori testing. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 The mutation analysis discriminated between p.F508del and the benign polymorphisms p.F508C, p.I506V, and p.I507V. Login to comment

[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]

Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
140 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p¼0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts. Login to comment
135 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p&#bc;0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts. Login to comment

[hide] Rapid screening for 31 mutations and polymorphisms... Methods Mol Med. 2005;114:147-71. Dunbar SA, Jacobson JW
Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array.
Methods Mol Med. 2005;114:147-71., [PMID:16156102]

Abstract [show]
A suspension array hybridization assay is described for the detection of 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using Luminex xMAP technology. The Luminex xMAP system allows simultaneous detection of up to 100 different targets in a single multiplexed reaction. Included in the method are the procedures for design of oligonucleotide capture probes and PCR amplification primers, coupling oligonucleotide capture probes to carboxylated microspheres, hybridization of coupled microspheres to oligonucleotide targets, production of targets from DNA samples by multiplexed PCR amplification, and detection of PCR-amplified targets by direct hybridization to probe-coupled microspheres. Mutation screening with the system is rapid, requires relatively few sample manipulations, and provides adequate resolution to reliably genotype the 25 CFTR mutations and 6 CFTR polymorphisms contained in the ACMG/ACOG/NIH-recommended core mutation panel for general population CF carrier screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 I506C, I507V, and F508C are performed only as reflex tests for unexpected homozygosity for ΔF508 and/or ΔI507. Login to comment
104 Nucleotides were added to the 5' and 3' ends of the probe sequences to improve hybridization efficiency of the probe to its perfect-match target, thus 152 Dunbar and Jacobson Table 2 (Continued) Target Microsphere Probe sequence Modificationb Sequence 5' → 3' set 46B 1898+1G→A 5'-AmMC12 TATTTGAAAGATATGTTCTTTG 027 47B 3120+1G 5'-AmMC12 CTTCATCCAGGTATGTAAAAAT 043 48B 3120+1G→A 5'-AmMC12 CTTCATCCAGATATGTAAAAAT 055 Reflex panel R2B I506V 5'-AmMC12 CACCAAAGATGACATTTTC 009 R3B I507V 5'-AmMC12 CACCAAAGACGATATTTTC 021 R4B F508C 5'-AmMC12 AACACCACAGATGATATTT 024 R5B 5T 5'-AmMC12 TGTGTGTTTTTAACAGGG 029 R6B 7T 5'-AmMC12 GTGTGTTTTTTTAACAGG 033 R7C 9T 5'-AmMC12 GTGTGTTTTTTTTTAACAG 037 a The position and sequence of the mutation or variation is indicated in bold type. b 5'-Amino modifier C12. Login to comment
106 Table 3 Reverse Complementary Oligonucleotide Targetsa Target Target sequence Modification Sequence 5' → 3' Standard mutation panel C1b I507 & F508 5'-Biotin AAAATATCATCTTTGGTGTT C2 ΔI507 5'-Biotin AAAGAAAATATCTTTGGTGT C3 ΔF508 5'-Biotin AGAAAATATCATTGGTGTTT C4 W1282 5'-Biotin GGCTTTCCTCCACTGTTGC C5 W1282X 5'-Biotin GGCTTTCCTTCACTGTTGC C6 1717-1G 5'-Biotin TGGAGATGTCCTATTACCAA C7 1717-1G→A 5'-Biotin TGGAGATGTCTTATTACCAA C8 G542 5'-Biotin CCACCTTCTCCAAGAACTAT C9 G542X 5'-Biotin CCACCTTCTCAAAGAACTAT C10 G551 & R553 5'-Biotin CTTGCTCGTTGACCTCCACT C11 G551D 5'-Biotin CTTGCTCGTTGATCTCCACT C12 R553X 5'-Biotin CTTGCTCATTGACCTCCACT C13 R560 5'-Biotin AGTTATTCACCTTGATAAAG C14 R560T 5'-Biotin AGTTATTCACGTTGCTAAAG C15 R117 5'-Biotin CGCGATAGAGCGTTCCTCCT C16 R117H 5'-Biotin CGCGATAGAGTGTTCCTCCT C17 I148 5'-Biotin CTGCATTCCAATGTGATGAA C18 I148T 5'-Biotin CTGCATTCCAGTGTGATGAA C19 621+1G 5'-Biotin GGAAGTATTACCTTCTTATA C20 621+1G→T 5'-Biotin GGAAGTATTAACTTCTTATA C21 N1303 5'-Biotin TTAGAAAAAACTTGGATCCC C22 N1303K 5'-Biotin TTAGAAAAAAGTTGGATCCC C23 1078T 5'-Biotin CTCAGGGTTCTTTGTGGTGT C24 1078delT 5'-Biotin TCTCAGGGTTCTTGTGGTGT C25 R334 5'-Biotin AATCATCCTCCGGAAAATAT C26 R334W 5'-Biotin AATCATCCTCTGGAAAATAT C27 R347 5'-Biotin ATTGTTCTGCGCATGGCGGT C28 R347P 5'-Biotin ATTGTTCTGCCCATGGCGGT C29 711+1G 5'-Biotin TAGGTACATACTTCATCAAA C30 711+1G→T 5'-Biotin TAGGTACATAATTCATCAAA C31 G85 5'-Biotin TAAAAAGATTCCATAGAACA C32 G85E 5'-Biotin TAAAAAGATTTCATAGAACA C33 3849+10kbC 5'-Biotin ATTAAAATGGCGAGTAAGAC C34 3849+10kbC→T 5'-Biotin ATTAAAATGGTGAGTAAGAC C35 A455 5'-Biotin CAGTTGTTGGCGGTTGCTGG C36 A455E 5'-Biotin CAGTTGTTGGAGGTTGCTGG C37 R1162 5'-Biotin ATCTGTGAGCCGAGTCTTTA C38 R1162X 5'-Biotin ATCTGTGAGCTGAGTCTTTA (Continued) Rapid CF Screening by xMAPTM 153 Table 3 (Continued) Target Target sequence Modification Sequence 5' → 3' C39 3659C 5'-Biotin GGTAAACCTACCAAGTCAAC C40 3659delC 5'-Biotin AGGTAAACCTACAAGTCAAC C41 2789+5G 5'-Biotin ACATGGAATACTCACTTTCC C42 2789+5G→A 5'-Biotin ACATGGAATATTCACTTTCC C43 2184A 5'-Biotin AAGATTGTTTTTTTGTTTCT C44 2184delA 5'-Biotin AAGATTGTTTTTTGTTTCTG C45 1898+1G 5'-Biotin AAAGAACATACCTTTCAAAT C46 1898+1G→A 5'-Biotin AAAGAACATATCTTTCAAAT C47 3120+1G 5'-Biotin TTTTTACATACCTGGATGAA C48 3120+1G→A 5'-Biotin TTTTTACATATCTGGATGAA Reflex panel CR2 I506V 5'-Biotin GAAAATGTCATCTTTGGTGT CR3 I507V 5'-Biotin GAAAATATCGTCTTTGGTGT CR4 F508C 5'-Biotin AAAATATCATCTGTGGTGTT CR5 5T 5'-Biotin TCCCTGTTAAAAACACACAC CR6 7T 5'-Biotin CCCTGTTAAAAAAACACACA CR7 9T 5'-Biotin CCTGTTAAAAAAAAACACAC a The position and sequence of the mutation or variation is indicated in bold type. b Target C1 (I507 & F508) is also used in the reflex panel. Login to comment
114 Using a small target DNA (approx 100-300 bp) minimizes the potential for steric hindrance to affect the xMAPTM Table 4 PCR Amplification Primers Size CFTR target Mutation(s) Primer 5' Modification Sequence 5' → 3' (bp) Exon 10 ΔI507, ΔF508, BE10U 5'-Biotin TTCTGTTCTCAGTTTTCCTGG 107 I506V, I507V, E10D None TTGGCATGCTTTGATGACG F508C Exon 20 W1282X E20U None TTGAGACTACTGAACACTGAAGG 126 BE20D 5'-Biotin TTCTGGCTAAGTCCTTTTGC Intron 10 1717-1G→A E11U None TCAGATTGAGCATACTAAAAGTGAC 89 BE11D2 5'-Biotin GAACTATATTGTCTTTCTCTGCAAAC Exon 11 G542X, G551D, E11U2 None AAGTTTGCAGAGAAAGACAATATAG 135 R553X, R560T BE11D 5'-Biotin GAATGACATTTACAGCAAATGC Exon 4 R117H E4U None TTTGTAGGAAGTCACCAAAGC 145 BE4D2 5'-Biotin GAGCAGTGTCCTCACAATAAAGAG Exon 4/intron 4 I148T, E4U2 None CTTCTCTTTATTGTGAGGACACTGC 169 621+1G→T BE4D 5'-Biotin ATGACATTAAAACATGTACGATACAG Exon 21 N1303K BE21U 5'-Biotin TGCTATAGAAAGTATTTATTTTTTCTGG 106 E21D None AGCCTTACCTCATCTGCAAC Exon 7 1078delT, BE7U 5'-Biotin GAACAGAACTGAAACTGACTCG 199 R334W, R347P E7D3 None CAGGGAAATTGCCGAGTG Intron 5 711+1G→T I5U None CAACTTGTTAGTCTCCTTTCC 99 BI5D2 5'-Biotin AGTTGTATAATTTATAACAATAGTGC Exon 3 G85E E3U None CTGGCTTCAAAGAAAAATCC 117 BE3D2 5'-Biotin TGAATGTACAAATGAGATCCTTACC Chromosome 7 3849+10kbC→T BC7U 5'-Biotin GACTTGTCATCTTGATTTCTGG 148 C7D None TTTGGTGCTAGCTGTAATTGC Exon 9 A455E BE9U 5'-Biotin TCACTTCTTGGTACTCCTGTCC 105 E9D None CAAAAGAACTACCTTGCCTGC Exon 19-I R1162X BE19U 5'-Biotin ATTGTGAAATTGTCTGCCATTC 167 E19Da None CAATAATCATAACTTTCGAGAGTTG Exon 19-II 3659delC BE19U2 5'-Biotin TTTAAGTTCATTGACATGCCAAC 91 E19Da None CAATAATCATAACTTTCGAGAGTTG Intron 14B 2789+5G→A I14BU None GTGTCTTGTTCCATTCCAGG 147 BI14BD 5'-Biotin TGGATTACAATACATACAAACATAGTGG Exon 13 2184delA E13U None AGATGCTCCTGTCTCCTGG 126 BE13D 5'-Biotin TGCACAATGGAAAATTTTCGTATAG Intron 12 1898+1G→A I12U None TTAGACTCTCCTTTTGGATACC 110 BI12D 5'-Biotin GTCTTTCTTTTATTTTAGCATGAGC Intron 16 3120+1G→A I16U None ATGACCTTCTGCCTCTTACC 118 BI16D 5'-Biotin ATGAAAACAAAATCACATTTGC Intron 8 5T/7T/9T I8U None TAATGGATCATGGGCCATGTGC 212 BI8D 5'-Biotin ACTGAAGAAGAGGCTGTCATCACC CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment
124 The M1 reaction was also used for detection of the I506V, I507V, and F508C polymorphisms in the reflex panel. Login to comment
259 Table7(continued) 167 Table 8 Allelic Ratio Data for the Reflex Panela Genotype I507 & F508 I506V I507Vb F508C Exon 10 variants ΔF508/ΔF508c - - - - ΔF508/Normal 0.93 0.03 0.02 0.02 Normal/Normal 0.94 0.03 0.01 0.01 ΔI507/Normal 0.97 0.04 -0.03 0.01 I506V/Normal 0.45 0.01 -0.01 0.54 F508C/Normal 0.40 0.58 0.00 0.01 Intron 8 variants Genotype 5T 7T 9T 7T/7T -0.06 1.06 0.01 7T/7T -0.01 1.00 0.01 7T/7T -0.01 1.01 0.00 9T/9T 0.05 0.05 0.90 9T/9T 0.07 0.05 0.87 7T/9T 0.04 0.45 0.51 7T/9T 0.03 0.40 0.56 5T/7T 0.42 0.60 -0.01 5T/7T 0.45 0.59 -0.04 5T/9T 0.36 0.00 0.64 a Positive alleles are indicated in bold type. b Samples positive for the I507V allele were not available. Login to comment

[hide] Modeling of nucleotide binding domains of ABC tran... J Bioenerg Biomembr. 1997 Oct;29(5):503-24. Bianchet MA, Ko YH, Amzel LM, Pedersen PL
Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Bioenerg Biomembr. 1997 Oct;29(5):503-24., [PMID:9511935]

Abstract [show]
Members of the ABC transporter superfamily contain two nucleotide binding domains. To date, the three dimensional structure of no member of this super-family has been elucidated. To gain structural insight, the known structures of several other nucleotides binding proteins can be used as a framework for modeling these domains. We have modeled both nucleotide binding domains of the protein CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) using the two similar domains of mitochondrial F1-ATPase. The models obtained, provide useful insights into the putative functions of these domains and their possible interaction as well as a rationale for the basis of Cystic Fibrosis causing mutations. First, the two nucleotide binding domains (folds) of CFTR are each predicted to span a 240-250 amino acid sequence rather than the 150-160 amino acid sequence originally proposed. Second, the first nucleotide binding fold, is predicted to catalyze significant rates of ATP hydrolysis as a catalytic base (E504) resides near the y phosphate of ATP. This prediction has been verified experimentally [Ko, Y.H., and Pedersen, P.L. (1995) J. Biol. Chem. 268, 24330-24338], providing support for the model. In contrast, the second nucleotide binding fold is predicted at best to be a weak ATPase as the glutamic acid residue is replaced with a glutamine. Third, F508, which when deleted causes approximately 70% of all cases of cystic fibrosis, is predicted to lie in a cleft near the nucleotide binding pocket. All other disease causing mutations within the two nucleotide binding domains of CFTR either reside near the Walker A and Walker B consensus motifs in the heart of the nucleotide binding pocket, or in the C motif which lies outside but near the nucleotide binding pocket. Finally, the two nucleotide binding domains of CFTR are predicted to interact, and in one of the two predicted orientations, F508 resides near the interface. This is the first report where both nucleotide binding domains of an ABC transporter and their putative domain-domain interactions have been modeled in three dimensions. The methods and the template used in this work can be used to analyze the structures and function of the nucleotide binding domains of all other members of the ABC transporter super-family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Importantly, missense mutations such as F508C, I506V and I507V are benign and do not cause the disease [Kobayashi et al. (1990)]. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 If indicated, testing includes reflex analysis for the following variants: 5/7/9T exon 9 splice acceptor tracts, F508C, I507V and I506V. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 For example, inability to confirm the variants in both parents may be found in cases with apparent homozygosity for a common or a rare variant: Nonpaternity Presence on the opposite allele of a large deletion, nonrevealed by routine tests Presence of a rare SNP in primer-binding sites or a rare DNA variant that causes failure of amplification and/or hybridization of a probe: for example, false homozygosity for p.Phe508del due to the presence of the variant F508C (c.1523T4G); false homozygosity for p.Ile507del due to the presence of p.Ile507Val (I597V) (c.1519A4G). Login to comment