ABCMdb

ABCC7 p.Trp401*

ClinVar:	c.1202G>A , p.Trp401* D , Pathogenic c.1203G>A , p.Trp401* D , Pathogenic
CF databases:	c.1202G>A or c.1203G>A , p.Trp401* D , CF-causing

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]

Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Sequences of the Primers Used for CFTR Analysis by HRM, GC Size, Amplicon Length, Number of Positive Controls Validated for Each Exon, and Positive Controls for Routine Analysis Exon Primer Sequences GC length Amplicon length (bp) Introns Number of heterozygous- positive controls Number of homozygous- positive controls Recommended control 1 LSCFE1Fmod 5Ј-CCGCCGCCGTTGAGCGGCAGGCACC-3Ј 8 200 bp 74 4 125GϾC LSCFE1Rmod 5Ј-CCGCCGCCGGCACGTGTCTTT CCGAAGCT-3Ј 8 19 M1I 2 2i5b 5Ј-CAAATCTGTATGGAGACC-3Ј 0 194 bp 39 5 R31C 2i3Љ 5Ј-CAACTAAACAATGTACATGAAC-3Ј 0 4 296ϩ1GϾT 3 LSCFe3Fmod LSCFe3Rmod 5Ј-CGCCGTTAAGGGAAATAGGACAA CTAAAATA-3Ј 5 276 bp 44 10 2 R75Q 5Ј-CCGCCGATTCACCAGATTTCGTAGTC-3Ј 6 66 G85V 4 LSCFe4FmodC 5Ј-CCGCCGCCGCCCGTGTTGAAATT CTCAGGGT-3Ј 12 361 bp 52 14 1 R117H LSCFe4RmodC 5Ј-CCGCCGCCCACATGTACGATAC AGAATATATGTGCC-3Ј 9 26 574delA 5 LSCFE5Fmod 5Ј-CCGCCGGTTGAAATTATCTAACTTTCC-3Ј 6 201 bp 13 8 624delT LSCFE5Rmod 5Ј-CCGAACTCCGCCTTTCCAGTTGT-3Ј 3 48 711ϩ1GϾT 6a LSCF6aFmod2 5Ј-CCGCCGGGGTGGAAGAT ACAATGACACCTG-3Ј 5 317 bp 25 8 C225X LSCF6aRmod2 5Ј-CCGCCGCCGCGATGCATAGAG CAGTCCTGGTT-3Ј 11 66 L206W 6b LSCFE6bFmod 5Ј-CGCGCCGCCGGATTTAC AGAGATCAGAGAG-3Ј 10 239 bp 0 2 1 R258G LSCFE6Brmod 5Ј-CCGCCGCCGAGGTGGA GTCTACCATGA-3Ј 8 66 1001ϩ11CϾT 7 LSCFE7Fmod2 5Ј-CCGCCGCCCTCTCCCTGAATTT TATTGTTATTGTTT-3Ј 13 326 bp 7 11 1078delT LSCFE7Rmod2 5Ј-CCCGCCGCCCTATAATGCAG CATTATGGT-3Ј 10 7 1248ϩ1GϾT 8 LSCFE8Fmod 5Ј-CCGGAATGCATTAATGCTAT TCTGATTC-3Ј 4 199 bp 32 7 W401X LSCFE8Rmod 5Ј-CCCGCAGTTAGGTGTTTAG AGCAAACAA-3Ј 4 18 1249-5AϾG 9 LSCFe9Fmod2 5Ј-CCGCCGCCGGGAATTATTTGAGAA AGCAAAACA-3Ј 8 279 bp 0 3 D443Y LSCFe9Rmod2 5Ј-CCGCCGCGAAAATACCTTCCAG CACTACAAACTAGAAA-3Ј 8 57 A455E 10 LSCF10FmodD 5Ј-CGCCGTTATGGGAGAACTGG AGCCTTCAGAG-3Ј 5 275 bp 0 15 1 F508del LSCF10RmodD 5Ј-CCGCAGACTAACCGATTGAAT ATGGAGCC-3Ј 4 68 E528E 11 h11i5 5Ј-TGCCTTTCAAATTCAGATTGAGC-3Ј 0 197 bp 42 13 2 G542X 11i3ter 5Ј-ACAGCAAATGCTTGCTAGACC-3Ј 0 17 G551D 12 LSCFE12Fmod 5Ј-CGCGTCATCTACACTAGATGACCAG-3Ј 4 244 bp 43 15 G576A 1898 ϩ 1GϾALSCFE12Rmod 5Ј-CCGGAGGTAAAATGCAATCTATGATG-3Ј 3 63 13 LSCF13AFmod 5Ј-CCGCCGCCGGAGACATATTG CAATAAAGTAT-3Ј 9 38 20 I601F LSCF13ARmod 5Ј-GCCTGTCCAGGAGACAGGA GCATCTC-3Ј 2 R668C LSCF13BFmod 5Ј-CCGCCGCAATCCTAACTGAG ACCTTACACCG-3Ј 2 R668C LSCF13BRmod 5Ј-CCGCCGATCAGGTTCAGGA CAGACTGC-3Ј 3 346 bp 2184insA LSCF13CFmod 5Ј-CCGCGGTGATCAGCACTGGCCC-3Ј 6 301 bp 77 L749L LSCF13CRmod 5Ј-CCGCGCGCGCGGCCAGTTTCTTG AGATAACCTTCT-3Ј 13 259 bp V754M LSCF13DFmod 5Ј-CGTGTCACTGGCCCCTCAGGC-3Ј 1 221 bp I807M LSCF13DRmof 5Ј-CCGCCGCCGCTAATCCTATGA TTTTAGTAAAT-3Ј 9 220 bp 2622ϩ1GϾA LSCf13FFmod 5Ј-CGCGGTGCAGAAAGAAGAAAT TCAATCCTAACTG-3Ј 4 R668C LSCF13FRmod 5Ј-CCGCCGTGCCATTCATTTGT AAGGGAGTCT-3Ј 6 2184insA 14a LSCF14aFmodB 5Ј-CCGACCACAATGGTGGCAT GAAACTG-3Ј 3 239 bp 35 7 1 T854T LSCF14aRmodB 5Ј-CCGCCGACTTTAAATCCAGTAAT ACTTTACAATAGAACA-3Ј 6 7 W846X 14b LSCF14bFmod 5Ј-CCGGAGGAATAGGTGAAGAT-3Ј 2 179 bp 38 4 2752-5GϾT LSCF14bRmodb 5Ј-CCGTACATACAAACATAGTGGATT-3Ј 3 59 2789ϩ5GϾT 15 LSCFE15Fmod 5Ј-CGCGCCGTGTATTGGAAA TTCAGTAAGTAACTTTGG-3Ј 7 412 bp 33 16 T908S LSCFE15Rmod 5Ј-CCGCAGCCAGCACTGCCAT TAGAAA-3Ј 4 68 S945L (table continues) phisms that we have chosen to exclude. Login to comment
91 Melting profiles of different mutations of exon 8: 1249-5AϾG, L375F, 1259insA, T388M, and W401X. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Solid phase fluorescent sequencing of the CFTR gen... Methods Mol Biol. 2001;167:63-88. Cuppens H, Cassiman JJ
Solid phase fluorescent sequencing of the CFTR gene.
Methods Mol Biol. 2001;167:63-88., [PMID:11265322]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
256 (B) A "G" to "A" nucleotide change at position 1335 of the CFTR gene in the W401X mutant. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb. Login to comment

[hide] Genotype-phenotype correlations for the paranasal ... Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6. Jorissen MB, De Boeck K, Cuppens H
Genotype-phenotype correlations for the paranasal sinuses in cystic fibrosis.
Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6., [PMID:10228103]

Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) have been found for lung and pancreatic function, but not for paranasal sinus disease. Because such correlations may have pathophysiological and clinical implications, the correlation of mutations, in particular DeltaF508, with paranasal sinus disease was investigated in 113 CF patients with known genotype. The clinical importance of paranasal sinus disease was evaluated using three parameters: polyps, overall clinical severity of upper airway problems, and surgery. Polyps were evaluated by nasal endoscopy and graded on a five-point scale. Four severity groups were distinguished based on history, clinical records, and examination: no upper airway problems; more problems than in control subjects; severe, recurrent or chronic problems; and paranasal sinus surgery cases. DeltaF508 homozygosity correlated with clinical severity (p < 0.02) and with the presence of polyps on endoscopy (p < 0.05). The relative risk for paranasal sinus surgery in DeltaF508 homozygous CF patients was 2.33. In conclusion, there are genotype-phenotype correlations for paranasal sinus disease in CF. DeltaF508 homozygosity is a risk factor for paranasal sinus disease in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 of Patients in Surgical Group ⌬F508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations ⌬F508 171 75.7 27 Non-⌬F508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,† ) A455E (1) G542X (4,‡ ) G551D (1) R553X (1) G628R(G→C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G→A (3,† ) 1898ϩ1G→C (1) 2183AA-G (3,†† ) 3659delC (2) 3272-26A→G (2,† ) 4218-insT (2) unknown (11,‡ ) * The genotype and mutations are given for the 113 patients with CF. Login to comment
121 of Patients in Surgical Group DF508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations DF508 171 75.7 27 Non-DF508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,ߤ ) A455E (1) G542X (4,ߥ ) G551D (1) R553X (1) G628R(G࢐C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G࢐A (3,ߤ ) 189811G࢐C (1) 2183AA-G (3,ߤߤ ) 3659delC (2) 3272-26A࢐G (2,ߤ ) 4218-insT (2) unknown (11,ߥ ) * The genotype and mutations are given for the 113 patients with CF. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 441delA, 557delT 711+1G>T, 711+3A>G H199Y, L206W 977insA R297Q 1078delT,R334W, 1154insTC, R347P W401X l46linsAGAT 1525- 1G>A, A1507, AI5071AF508. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] CFTR haplotype backgrounds on normal and mutant CF... Hum Mol Genet. 1994 Apr;3(4):607-14. Cuppens H, Teng H, Raeymaekers P, De Boeck C, Cassiman JJ
CFTR haplotype backgrounds on normal and mutant CFTR genes.
Hum Mol Genet. 1994 Apr;3(4):607-14., [PMID:7520797]

Abstract [show]
Ten polymorphic loci, located in a 1 Mb interval across the cystic fibrosis locus, were analyzed on normal and mutant CFTR genes. A different distribution of haplotype backgrounds among normal and mutant CFTR genes was observed. With exception of the D7S8 locus, the three most common mutations, delta F508, G542X and N1303K, were found on an identical haplotype background. In agreement with the observed linkage equilibrium between the Q1463Q and D7S8 loci, both alleles at the D7S8 locus were found on delta F508 CFTR genes. However, the G542X and N1303K mutations, which have been estimated to be at least 35000 years old, were found to be associated with a single allele at the D7S8 locus. Absence of recombination between the D7S8 and Q1463Q loci was also observed on normal CFTR genes with this haplotype background. At the Tn locus in intron 8, allele 9 known to result in very efficient splicing was associated with the most frequent mutations. At the M470V locus, located in a conserved region of the first nucleotide binding fold, the amino acid methionine was found to be associated with the frequent mutations, in particular with mutations located in one of the two nucleotide binding folds which are generally known as severe mutations with regard to exocrine pancreatic function. On mutant CFTR gene, this locus was in complete association with the centromeric D9 locus, in the absence of a complete association with the intervening loci.(ABSTRACT TRUNCATED AT 250 WORDS)

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Distribution of alleles at 10 polymorphic loci Locus Allele Normal Mutant Mutations XV2c KM19 D9 1 2 1 2 1 2 58 (0.492) 60 (0.508) 84 (0.622) 51 (0.378) 78 (0.586) 55 (0.414) 146 (0.918) 13 (0.082) 19(0.109) 156 (0.891) 15 (0.085) 161 (0.915) 1001 + llC/T Tn 115 (0.927) R 9 (0.073) 5 7 (0.057) 7 102 (0.836) 9 13 (0.107) M470V C 62 (0.496) R 63 (0.504) 1898+15 2T/A C 84(0.641) R 47 (0.359) T854T Q1463Q D7S8 C 82 (0.636) R 47 (0.364) C 90 (0.692) R 40 (0.308) 1 38 (0.317) 2 82 (0.683) 33 (0.192) 139 (0.808) 0 (0.000) 32 (0.190) 136 (0.810) 156 (0.902) 17 (0.098) 163 (0.926) 13 (0.074) 162 (0.926) 13 (0.074) 162 (0.931) 12 (0.069) 91 (0.569) 69 (0.431) E60X, 622-2A-C, A455E, AF508 (98.3%), 1717-1G-A, G542X, 0.479 63.54 G628R(G-C)/S1235R,2183AA-G, G970R, W1282X, N1303K p<10~ G458V, AI5O7, AF508 (1.7%), 1898 + 1G-C, E73OX, 3272-26A-G, W1310X, 4218insT, UA, UB, UC I336K, W401X, 2T2ldelll, Y1092X, 3659delC, S1251N: not included (5%) E60X, 622-2A-C, W401X, G458V, AF5O8 (1.6%), 1898+ 1G-C, -0.541 90.63 G628R(G-Q/S1235R, E730X, G970R, 3272-26A-G (50.0%), p<10" Y1092X, 3659delC, S1251N, W1310X, UB, UTC A455E, AI507, AF5O8 (98.4%), 1717- 1G-A, G542X, 2183AA-G, 3272-26A-G (50.0%), W1282X, N13O3K, 4218insT, UA 1336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, G458V, 1898 +1G-C, E730X, G970R, -0.541 90.46 Y1092X, 3659delC, S1251N, W1310X, UB, UC p<10" A455E, AI507, AF508, 1717- 1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA I336K, 2721delll: not included (1%) E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717- 1G-A, -0.726 155.94 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, p< 10" G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717-1G-A, 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K A455E, AI5O7, AF508, 1717-1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA E60X, 622-2A-C, W401X, G458V, 1898 + 1G-C, E730X, G970R, Y1092X, 3659delC, S1251N, W1310X, UB, UC 1336K, midclll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898 + 1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N, N1303K, W1310X, UB, UC AI507, AF5O8 (0.8%), 1717-1G-A, G628R(G-Q/S1235R, 3272-26A-G, W1282X, 4218insT, UA I336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898+1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC,S1251N, N13O3K, W1310X, UB, UC AI507, AF508 (0.8%), 1717-1G-A, G628R(G-C)/S1235R, 3272-26A-G, W1282X, 4218insT, UA 1336K, midelll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF5O8 (99.2%), G542X, G628R(G-Q/S1235R, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N,N1303K, W1310X, UC AI507, AF5O8 (0.8%), 1717-1G-A, 1898 + 1G-C, 3272-26A-G, W1282X, 4218insT 1336K, 2721del11. Login to comment
35 UA, UB: not included (2%) A455E, AF508 (61.2%), 1717-1G-A (66.7%), G542X, G628R(G-C)/S1235R, 3272-26A-G, S1251N, W1282X, W1310X E60X, 622-2A-C, W401X, G458V, AJ507, AF5O8 (38.8%), 1717- 1G-A (33.3%), 1898 +1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC, N13O3K, 4218insT, UA, UB, UC 1336K, 2721delll: not included (1%) -0.694 139.81 p<10~ 0.452 60.83 p<10" 0.355 38.77 p<10" 0.360 39.44 p<10~7 0.314 29.91 0.250 17.54 p<10"4 The observed CFTR genes associated with a particular allele are given, proportions are given between brackets. Not all the mutations were informative for each of the tested loci, which were therefore not included. For the Tn locus the standardized linkage disequilibrium coefficient was calculated for the group of the non-T9 alleles and the T9 alleles. Login to comment
73 The I336K, W401X, 2721delll, Y1092X, 3659delC and S1251N mutations, contributing for 5% of all mutant CFTR genes, are not included. Login to comment
103 CFTR haplocypes I II ma mb rv V VI Haplotype C7RCCC 211C7RCCC1 111C7RCCC1 /11C7RCCC1 211C7RCCC2 111C7RCCC2 /11C7RCCC2 122C7RCCC2 121C7RCCC2 C5CRRR 122C5CRRR1 211C5CRRR2 222C5CRRR2 C7CRRR 122C7CRRR1 222C7CRRR1 212C7CRRR1 122C7CRRR2 222C7CRRR2 122C7CRRR/ C9CRRR 211C9CRRR1 R9CCCC 122R9CCCC1 222R9CCCC1 /22R9CCCC1 112R9CCCC1 122R9CCCC2 222R9CCCC2 112R9CCCC2 R9CRRR 122R9CRRR1 C7CRRC 112C7CRRC1 112C7CRRC2 C9CRRC 211C9CRRC1 C7CCCC 211C7CCCC1 222C7CCCC1 122C7CCCC2 C7RCCR 211C7RCCR2 Normal 0.524 (43) 0.085 0.073 0.195 0.146 0.012 0.012 0.049 (4) 0.012 0.024 0.012 0.220 (18) 0.024 0.073 0.000 0.073 0.049 0.012 (1) 0.012 0.073 (6) 0.000 0.000 0.000 0.061 0.012 0.000 0.000 (0) 0.000 0.061 (5) 0.000 0.061 0.012 (1) 0.012 0.037 (3) 0.012 0.024 0.000 0.012 (1) 0.012 Mutant 0.080 (IS) 0.005 0.000 0.020 0.015 0.020 0.020 0.000 0.000 0.000 (0) 0.000 0.000 0.000 Mutations p<10"7 W1310X S1251N G458V, E730X, UC E60X, 622-2A-C, G970R W401X, Y1092X, 3659delC 0.055 (9) p<10"2 0.017 0.005 0.005 0.008 0.010 0.010 0.000 (0) 0.000 1717-1G-A (66.7%) 50.0% of 3272-26A-G 50.0% of 3272-26A-G 1717-1G-A(33.3%) AI507, 4218insT W1282X 0.819 (130) p<10~7 0.466 0.007 0.010 0.007 0.312 0.007 0.007 0.005 (1) 0.005 0.005 (1) 0.005 0.000 0.000 (0) 0.000 0.010 (2) 0.000 0.000 0.010 0.005 (1) 0.005 56.7% of AF508, G542X 1% of AF5O8 A455E 1% of AF5O8 38.1% of AF508, N1303K 1.0% of AF5O8 1% of AF508 1% of AF508 G628R(G-Q/S1235R 2183AA-G 1898+1G-C The proportion of CFTR genes associated with a particular haplotype, and the mutations found to be associated with that haplotype are given. Login to comment

[hide] Detection of 98.5% of the mutations in 200 Belgian... Genomics. 1993 Dec;18(3):693-7. Cuppens H, Marynen P, De Boeck C, Cassiman JJ
Detection of 98.5% of the mutations in 200 Belgian cystic fibrosis alleles by reverse dot-blot and sequencing of the complete coding region and exon/intron junctions of the CFTR gene.
Genomics. 1993 Dec;18(3):693-7., [PMID:7508414]

Abstract [show]
We have previously shown that about 85% of the mutations in 194 Belgian cystic fibrosis alleles could be detected by a reverse dot-blot assay. In the present study, 50 Belgian chromosomes were analyzed for mutations in the cystic fibrosis transmembrane conductance regulator gene by means of direct solid phase automatic sequencing of PCR products of individual exons. Twenty-six disease mutations and 14 polymorphisms were found. Twelve of these mutations and 3 polymorphisms were not described before. With the exception of one mutant allele carrying two mutations, these mutations were the only mutations found in the complete coding region and their exon/intron boundaries. The total sensitivity of mutant CF alleles that could be identified was 98.5%. Given the heterogeneity of these mutations, most of them very rare, CFTR mutation screening still remains rather complex in our population, and population screening, whether desirable or not, does not appear to be technically feasible with the methods currently available.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 First, a stop at nucleotide position 1258 in the exSi fragment was seen in individuals heterozygous for the W401X mutation, which is located in exon 8. Login to comment
24 This stop was never seen in non-W401X alleles. Login to comment
25 The presence of an A at nucleotide position 1335 in the W401X allele may alter the conformation of the ex8i fragment thereby hampering the progression of the T 7 DNA polymerase. Login to comment
43 TABLE 1 Mutations (and Their Frequencies) Identified in This Study Predicted amino Mutation Nucleotide change~ acid change Location Frequencyb Reference E60X G --~ T at 310 (TAGATAGCT) Glu --~ Stop at 60 Malone et al. in (21); this study G --~ A at 482 (GAACACTCT) (8) A --~ C at 622-2 (TTTTCGACT) This study T --~ A at 1139 (AAAAAATTC) This study G --~ A at 1335 (TCTGAGAGG) This study C --~ A at 1496 (TTGGAGGTT) (14) G -~ T at 1505 (GCTGTATCC) (6) Deletion of ATC from 1651 (14); Schwarz et al. (TATC_TTTG) in (21) Deletion of CTT from 1653 145 (13) (TCAT_TGGT) G --~ A at 1717-1 (AATAAGACA) G --~ T at 1756 (TCTTTGAGA) G --~ C at 1898 + 1 (AAAGCTATG) G --~ C at 2014 (TTATCGGAC Deletion of A at 2184; A --~ G at 2183 (AAAAG CAAT) G --~ T at 2320 (TGATTAGCC Deletion of 11 nucleotides from 2721 (TGCT_TAGT) G --~ C at 3040 (AGCACGTAC A --~ G at 3272-26 (TGCAGTGTT) C --~ A at 3408 (TGTAACTGT) Deletion of C at 3659 (CCTA_CAAG) T --~ G at 3837 (TAAGGCCTG G --* A at 3884 (AAGAATACT G --~ A at 3978 (AGTGAAGGA' C --~ G at 4041 (AAAAGTTGG G -~ A at 4061 (CAGTAGAGT Insertion of T after 4218 (CAGTTAAGG) R117H 622-2A --~ C I336K W401X A455E G458V AI507 AF508 1717-1G -~ A G542X 1898+ 1G-~C G628R(G -~ C) 2184delA plus A -~ G at 2183 E730X 2721de111 G970R 3272-26A --~ G Y1092X 3659delc $1235R $1251N W1282X N1303K W1310X 4218insT Exon 3 2 (1.0%) Arg --~ His at 117 Exon 4 c 3' splice signal Intron 4 1 (0.5%) Ile -~ Lys at 336 Exon 7 1 (0.5%) Trp --~ Stop at 401 Exon 8 2 (1.0%) Ala --~ Glu at 455 Exon 9 2 (1.0%) Gly --* Val at 458 Exon 9 1 (0.5%) Deletion of Ile 507 Exon 10 1 (0.5%) Deletion of Phe 508 Exon 10 (72.5%) 3' splice signal Intron 10 5 (2.5%) Gly --* Stop at 542 Exon 11 11 (5.5%) 5' splice signal Intron 12 1 (0.5%) Gly -~ Arg at 628 Exon 13 1 (0.5%) Frameshift Exon 13 2 (1.0%) Glu --~ Stop at 730 Exon 13 1 (0.5%) Frameshift Exon 14a I (0.5%) Gly --~ Arg at 970 Exon 15 1 (0.5%) 5' splice signal? Login to comment
42 TABLE 1 Mutations (and Their Frequencies) Identified in This Study Predicted amino Mutation Nucleotide change~ acid change Location Frequencyb Reference E60X G --~ T at 310 (TAGATAGCT) Glu --~ Stop at 60 Malone et al. in (21); this study G --~ A at 482 (GAACACTCT) (8) A --~ C at 622-2 (TTTTCGACT) This study T --~ A at 1139 (AAAAAATTC) This study G --~ A at 1335 (TCTGAGAGG) This study C --~ A at 1496 (TTGGAGGTT) (14) G -~ T at 1505 (GCTGTATCC) (6) Deletion of ATC from 1651 (14); Schwarz et al. (TATC_TTTG) in (21) Deletion of CTT from 1653 145 (13) (TCAT_TGGT) G --~ A at 1717-1 (AATAAGACA) G --~ T at 1756 (TCTTTGAGA) G --~ C at 1898 + 1 (AAAGCTATG) G --~ C at 2014 (TTATCGGAC Deletion of A at 2184; A --~ G at 2183 (AAAAG CAAT) G --~ T at 2320 (TGATTAGCC Deletion of 11 nucleotides from 2721 (TGCT_TAGT) G --~ C at 3040 (AGCACGTAC A --~ G at 3272-26 (TGCAGTGTT) C --~ A at 3408 (TGTAACTGT) Deletion of C at 3659 (CCTA_CAAG) T --~ G at 3837 (TAAGGCCTG G --* A at 3884 (AAGAATACT G --~ A at 3978 (AGTGAAGGA' C --~ G at 4041 (AAAAGTTGG G -~ A at 4061 (CAGTAGAGT Insertion of T after 4218 (CAGTTAAGG) R117H 622-2A --~ C I336K W401X A455E G458V AI507 AF508 1717-1G -~ A G542X 1898+ 1G-~C G628R(G -~ C) 2184delA plus A -~ G at 2183 E730X 2721de111 G970R 3272-26A --~ G Y1092X 3659delc $1235R $1251N W1282X N1303K W1310X 4218insT Exon 3 2 (1.0%) Arg --~ His at 117 Exon 4 c 3' splice signal Intron 4 1 (0.5%) Ile -~ Lys at 336 Exon 7 1 (0.5%) Trp --~ Stop at 401 Exon 8 2 (1.0%) Ala --~ Glu at 455 Exon 9 2 (1.0%) Gly --* Val at 458 Exon 9 1 (0.5%) Deletion of Ile 507 Exon 10 1 (0.5%) Deletion of Phe 508 Exon 10 (72.5%) 3' splice signal Intron 10 5 (2.5%) Gly --* Stop at 542 Exon 11 11 (5.5%) 5' splice signal Intron 12 1 (0.5%) Gly -~ Arg at 628 Exon 13 1 (0.5%) Frameshift Exon 13 2 (1.0%) Glu --~ Stop at 730 Exon 13 1 (0.5%) Frameshift Exon 14a I (0.5%) Gly --~ Arg at 970 Exon 15 1 (0.5%) 5' splice signal? Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment