ABCMdb

ABCC7 p.Ser549Ile

ClinVar:	c.1647T>G , p.Ser549Arg D , Pathogenic c.1645A>C , p.Ser549Arg D , Pathogenic c.1646G>T , p.Ser549Ile D , Pathogenic
CF databases:	c.1646G>A , p.Ser549Asn D , CF-causing ; CFTR1: c.1645A>C or c.1647T>G , p.Ser549Arg D , CF-causing ; CFTR1: ; CFTR1: The CF chromosome with this mutation is carried by a non-Ashkenazic Jewish patient in Morocco. The chromosome also has the B haplotype. Detection of this mutation may be achieved by ASO hybridization or allele-specific PCR. c.1646G>T , p.Ser549Ile (CFTR1) ? , This mutation destroys a Ddel site, similar to G549N, and therefore one cannot distinguish the two by Ddel digestion.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (59%), K: D (95%), L: D (95%), M: D (95%), N: N (72%), P: D (95%), Q: D (95%), R: N (57%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Frequency of CFTR gene mutations in males particip... Hum Reprod. 1999 Jul;14(7):1833-4. Jakubiczka S, Bettecken T, Stumm M, Nickel I, Musebeck J, Krebs P, Fischer C, Kleinstein J, Wieacker P
Frequency of CFTR gene mutations in males participating in an ICSI programme.
Hum Reprod. 1999 Jul;14(7):1833-4., [PMID:10402399]

Abstract [show]
A higher prevalence of cystic fibrosis transmembrane regulator (CFTR) gene mutations has been suggested both in men affected by congenital aplasia of the vas deferens, and in individuals presenting with reduced sperm quality. In this case, an increased risk for offspring being affected by cystic fibrosis (CF) can be expected in couples who are planning to undergo intracytoplasmic sperm injection (ICSI), since most of the male partners suffer from infertility. In order to determine the risk for these couples more precisely, we offered them a test for the most frequent CF mutations prevalent in the German population. The frequency of mutations within the CFTR gene in the female group was in the same range as expected for the general population (six out of 150). In 10 out of 207 males tested, infertility could be explained by exogenous factors not related to CFTR. Among the remaining 197 males with idiopathic infertility, we detected 13 heterozygotes for a mutation within the CFTR gene. This slightly, but significantly (P = 0.014), elevated rate could indicate that infertile males have, compared with the general population, an increased risk of being a carrier of a CFTR gene mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 Materials and methods CFTR screening included the most frequent CFTR mutations in the German population (R347P, ∆F508, G542X, S549I,N,R(A→C), G551D, R553X, N1303K, and 3849ϩ10kbC→T) (Do¨rk et al., 1994) as well as the mutation R117H and the analysis of the IVS8-T haplotype. Login to comment

[hide] Three common CFTR mutations should be included in ... Clin Genet. 1999 Oct;56(4):318-22. Schaedel C, Hjelte L, de Monestrol I, Johannesson M, Kollberg H, Kornfalt R, Holmberg L
Three common CFTR mutations should be included in a neonatal screening programme for cystic fibrosis in Sweden.
Clin Genet. 1999 Oct;56(4):318-22., [PMID:10636451]

Abstract [show]
Children with cystic fibrosis (CF) diagnosed by neonatal screening have a better nutritional development and other advantages compared with those in a nonscreened group. The two-tier immunoreactive trypsinogen (IRT)/DNA screening protocol has been found superior to the single-tier IRT approach, improving the positive predictive value and thus reducing the false-positive rate. However, variations of the DNA test are required for different populations. In this study we examined CFTR (cystic fibrosis transmembrane conductance regulator) mutations in 331 CF patients attending the centres in Stockholm, Lund and Uppsala, comprising about 75% of the CF population in Sweden. The frequency of deltaF508 among CF alleles was 68.3%. There were two other mutations, 394delTT and 3659delC, found to be fairly frequent, amounting to 8.5 and 7.9%, respectively. Other mutations were comparatively rare. A simple and effective method of analysing the three mutations from Guthrie cards has been developed. Assuming Hardy-Weinberg equilibrium, 90% of our CF patients will be expected to carry at least one deltaF508 allele and 97.6% to carry at least one deltaF508, 394delTT or 3659delC copy. Including the latter two in a screening programme would thus substantially reduce the risk of a false-negative outcome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 patients 1 S549I/S549I Lebanon I148T/unknown1 Turkey 1 711+3GA/ Italy G1244E R553X/G551D1 France 2 R553X/unknown Sweden, Germany 175insT/175insT Sweden2 R117H/unknown2 Sweden 3 Unknown/unknown Sweden, Syria, Turkey early intervention (1, 3). Login to comment

[hide] Partial CFTR genotyping and characterisation of cy... Clin Genet. 2000 Jan;57(1):56-60. Zebrak J, Skuza B, Pogorzelski A, Ligarska R, Kopytko E, Pawlik J, Rutkiewicz E, Witt M
Partial CFTR genotyping and characterisation of cystic fibrosis patients with myocardial fibrosis and necrosis.
Clin Genet. 2000 Jan;57(1):56-60., [PMID:10733236]

Abstract [show]
Myocardial necrosis and fibrosis is a rare complication of cystic fibrosis (CF) causing sudden and unexpected death in infancy due to cardiac arrest. Characteristic morphological lesions are recognisable postmortem. The 18 CF patients with this complication had varied clinical features including mild pulmonary involvement, early onset severe pancreatic insufficiency, and profound electrocardiogram (ECG) changes. In this group of patients, 5 were deltaF508 homozygotes, 1 was deltaF508/ N1303K and 1 was a deltaF508/M compound heterozygote. A pair of affected siblings (deltaF508 homozygotes) were fully concordant for myocardial involvement and for the general course of the disease. The co-existence of a genetic predisposition to myocardial lesions resulting most probably from severe cystic fibrosis transmembrane (CFTR) genotypes (such as deltaF508/deltaF508, deltaF508/N1303K) and deficiency of certain trophic factors necessary for metabolism of the myocardium, are postulated to cause myocardial complications in CF leading to circulatory failure and early death.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 The latter was negative for 14 other mutations: DI507, 1717-1GA, G542X, G551D, R553X, R560T, 3849+10kbCT, N1303K, W1282X, S549I, S549N, 621+1GT, 2789+5GA, R117H. Login to comment

[hide] Unilateral renal agenesis associated with congenit... Hum Reprod. 2001 Feb;16(2):282-8. McCallum T, Milunsky J, Munarriz R, Carson R, Sadeghi-Nejad H, Oates R
Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations.
Hum Reprod. 2001 Feb;16(2):282-8., [PMID:11157821]

Abstract [show]
An association between congenital bilateral absence of the vas deferens (CBAVD), normal renal anatomy and cystic fibrosis (CF) gene mutations is well established (CF/CBAVD). We postulate that unilateral renal agenesis (URA) and CBAVD (URA/CBAVD) may have a non-CF mutation-mediated genetic basis that leads to abnormal development of the entire mesonephric duct at a very early stage in embryo development (< or =7 weeks). The physical, laboratory and radiographic findings of men with URA/CBAVD (n = 17) and CF/CBAVD (n = 97) were compared; the fertilization and pregnancy rates in the URA/CBAVD population calculated, and the incidence of renal agenesis in immediate family members and offspring of men with URA/CBAVD analysed. No statistical differences could be identified within any of the above comparisons. The fertilization rate for the URA/CBAVD group was 58.2 +/- 26.3%. Eight infants and two fetuses had normal renal anatomy, while one terminated male fetus had bilateral renal and vasal agenesis. Thirty first-order relatives had normal renal units. Anatomical expression of the reproductive ductal derivatives in men with URA/CBAVD and CF/CBAVD was similar, but the phenotypic outcome of the renal portion of the mesonephric duct was different. The potential for transmission of this fatal anomaly reinforces the need for prenatal ultrasounds with all pregnancies involving URA/CBAVD men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 These were G91R, 711 ϩ 5GϾA, T338I, 712-1GϾT, Q359K/T360K, 1161delC, 1609delCA, S549I, Q552X, 1949del84, 1989 ϩ 5GϾT, S1251N, and R1283M. Login to comment

[hide] The S549R (T-->G) cystic fibrosis gene mutation. J Trop Pediatr. 2001 Aug;47(4):196-8. Dawson KP, Frossard PM
The S549R (T-->G) cystic fibrosis gene mutation.
J Trop Pediatr. 2001 Aug;47(4):196-8., [PMID:11523757]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 There have been four separate mutations described in codon 549, namely S549R (A➝C), S549I, S549R (T➝G), and S549N2 (codons = triplet codes for each amino acid). Login to comment

[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]

Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment

[hide] Complete screening of the CFTR gene in Argentine c... Clin Genet. 2002 Mar;61(3):207-13. Visich A, Zielenski J, Castanos C, Diez G, Grenoville M, Segal E, Barreiro C, Tsui LC, Chertkoff L
Complete screening of the CFTR gene in Argentine cystic fibrosis patients.
Clin Genet. 2002 Mar;61(3):207-13., [PMID:12000363]

Abstract [show]
In order to establish the nature and the distribution of mutations causing cystic fibrosis (CF) in 220 unrelated Argentine families, the present authors conducted an extensive molecular analysis of the CF transmembrane regulator (CFTR) gene. First, a direct mutation analysis of 13 common mutations was done, enabling the detection of 319 out of 440 CF alleles (72.52%). Then an exhaustive screening of the entire coding region and the adjacent sequences of the CFTR gene was performed in all patients carrying at least one unidentified CF allele using the multiplex heteroduplex analysis assay followed by direct DNA sequencing. Thirty-nine different CF mutations, including five previously undescribed mutations (i.e. L6V, Y362X, 1353insT, 2594delGT and 2686insT) and two novel polymorphisms (i.e. 1170G/C and 3315A/C) were identified. As a result, the overall detection rate increased by up to 83.45%. Besides DeltaF508, only five mutations showed frequencies higher than 1%. In addition, a total of 49% of the mutations were rare because they were found in only one CF family. This wide spectrum of CF mutations is in agreement with the heterogeneous ethnic origin of the Argentine population. The data obtained here may have important consequences for the development of adequate strategies for the molecular diagnosis of CF in Argentina.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Screening for DF508 and 12 other known mutations DF508 and 11 other frequent mutations (i.e. DI507, G551D, R553X, S549N, S549I, R1162X, 1811π1.6KbA»T, G542X, 1717-1G»A, 208 W1282X and N1303K) were detected as previously described (5). Login to comment

[hide] Predictors of deterioration of lung function in cy... Pediatr Pulmonol. 2002 Jun;33(6):483-91. Schaedel C, de Monestrol I, Hjelte L, Johannesson M, Kornfalt R, Lindblad A, Strandvik B, Wahlgren L, Holmberg L
Predictors of deterioration of lung function in cystic fibrosis.
Pediatr Pulmonol. 2002 Jun;33(6):483-91., [PMID:12001283]

Abstract [show]
The severity of lung disease in cystic fibrosis (CF) may be related to the type of mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and to environmental and immunological factors. Since pulmonary disease is the main determinant of morbidity and mortality in CF, it is important to identify factors that can explain and predict this variation. The aim of this longitudinal study of the whole Swedish CF population over age 7 years was to correlate genetic and clinical data with the rate of decline in pulmonary function. The statistical analysis was performed using the mixed model regression method, supplemented with calculation of relative risks for severe lung disease in age cohorts.The severity of pulmonary disease was to some extent predicted by CFTR genotype. Furthermore, the present investigation is the first long-term study showing a significantly more rapid deterioration of lung function in patients with concomitant diabetes mellitus. Besides diabetes mellitus, pancreatic insufficiency and chronic Pseudomonas colonization were found to be negative predictors of pulmonary function. In contrast to several other reports, we found no significant differences in lung function between genders. Patients with pancreatic sufficiency have no or only a slight decline of lung function with age once treatment is started, but an early diagnosis in this group is desirable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment

[hide] Cystic fibrosis as a cause of infertility. Reprod Biol. 2004 Jul;4(2):119-29. Jarzabek K, Zbucka M, Pepinski W, Szamatowicz J, Domitrz J, Janica J, Wolczynski S, Szamatowicz M
Cystic fibrosis as a cause of infertility.
Reprod Biol. 2004 Jul;4(2):119-29., [PMID:15297887]

Abstract [show]
Cystic fibrosis (CF) is one of the autosomal recessive diseases, caused by mutations in a gene known as cystic fibrosis transmembrane regulator (CFTR). The majority of adult males with CF (99%) is characterized by congenital bilateral absence of vas deferens (CBAVD). CBAVD is encountered in 1-2% of infertile males without CF. Females with CF are found to be less fertile than normal healthy women. In females with CF, delayed puberty and amenorrhoea are common due to malnutrition. CFTR mutations are also associated with congenital absence of the uterus and vagina (CAUV). The National Institutes of Health recommend genetic counseling for any couple seeking assisted reproductive techniques with a CF male or obstructive azoospermia which is positive for a CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 CFTR screening includes the most frequent CFTR mutations, for example in the German population: ΔF508, R347P, G542X, S549I, N, R (A→C), G551D, R553X, N1303K, 3849+10kbC→T [11]. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Mild cystic fibrosis mutations in Southern Sweden ... Clin Genet. 1998 May;53(5):383-6. Schaedel C, Andersson AM, Kristoffersson AC, Kornfalt R, Lannefors L, Holmberg L
Mild cystic fibrosis mutations in Southern Sweden with special reference to S549I and T338I.
Clin Genet. 1998 May;53(5):383-6., [PMID:9660057]

Abstract [show]
In this study of cystic fibrosis (CF) gene mutations in Southern Sweden we found missense mutations in 12 out of 110 patients. These patients, as a group, differed from deltaF508 homozygotes by a higher frequency of pancreatic sufficiency and an older age at diagnosis as has been indicated in previous studies. In addition, lung function (vital capacity (VC) and forced expiratory volume in 1 s (FEV1)) tended to be better although the difference did not reach statistical significance (p = 0.13 for FEV1). For two mutations, S549I and T338I, our results differed from earlier reports. In our experience, S549I confers a milder phenotype and T338I a more severe one than previously reported. We conclude that each mutation should be treated separately when trying to correlate genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Here we compare the clinical picture in a group of patients with missense mutations or the 5T allele with that in AF508 homozygotes and, especially, describe the features in the S549I and T338I mutations, for which our experience differs from earlier reports. Login to comment
38 All but two of the patients had a 'severe' mutation (AF508, 394delTT or 3659delC) on the other chromosome, whereas one was homozygous for the S549I mutation, and one had an unknown mutation on the other allele. Login to comment
51 A 9-year-old girl was homozygous for the S549I mutation. Login to comment
66 However, they differ with respect to the T338I and S549I mutations. Login to comment
75 The S549I mutation, first described in Arabs, was reported by Kerem et al. (12) to be associated with the pancreatic insufficient phenotype. Login to comment
83 In conclusion, our study extends clinical data for two CF gene deficiencies T338I and S549I. Login to comment

[hide] Molecular analysis of ABCD1 gene in Indian patient... Clin Chim Acta. 2011 Nov 20;412(23-24):2289-95. Epub 2011 Aug 26. Shukla P, Gupta N, Gulati S, Ghosh M, Vasisht S, Sharma R, Gupta AK, Kalra V, Kabra M
Molecular analysis of ABCD1 gene in Indian patients with X-linked adrenoleukodystrophy.
Clin Chim Acta. 2011 Nov 20;412(23-24):2289-95. Epub 2011 Aug 26., [PMID:21889498]

Abstract [show]
BACKGROUND: X-linked Adrenoleukodystrophy (X-ALD), with an incidence of 1:14,000 is the most frequent monogenic demyelinating disorder worldwide. The principal biochemical abnormality in X-ALD is the increased levels of saturated, unbranched very long chain fatty acids (VLCFA). It is caused by mutations in ABCD1 gene. No molecular data on X-ALD is available in India and mutational spectrum in Indian patients is not known. METHODS: We standardized conformation sensitive gel electrophoresis (CSGE) method to detect mutations in ABCD1 gene in twenty Indian patients with X-ALD. The results were confirmed by sequencing. Genotype-phenotype correlation was also attempted. Prenatal diagnosis (PND) in one family was done using chorionic villi (CV) sample at 12 weeks of gestation. RESULTS: Out of twenty, causative mutations could be identified in twelve patients (60%). Six reported and four novel mutations were identified. Three polymorphisms were also observed. No hot spot was found. No significant genotype-phenotype correlation could be established. CONCLUSIONS: The study identified the mutation spectrum of Indian X-ALD patients, which enabled us to offer accurate genetic counseling, carrier detection and prenatal diagnosis where needed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 The CFTR mutants p.Ser549Ile, p.Ser549Arg, that involve the same amino acid position as in the ALD mutant fail to produce mature CFTR and therefore prevent trafficking to the correct cellular localization [18]. Login to comment

[hide] The D1152H cystic fibrosis mutation in prenatal ca... J Med Screen. 2011;18(4):169-72. Epub 2011 Dec 7. Peleg L, Karpati M, Bronstein S, Berkenstadt M, Frydman M, Yonath H, Pras E
The D1152H cystic fibrosis mutation in prenatal carrier screening, patients and prenatal diagnosis.
J Med Screen. 2011;18(4):169-72. Epub 2011 Dec 7., [PMID:22156145]

Abstract [show]
OBJECTIVE: To assess the frequency of the D1152H mutation in the CFTR gene in normal individuals, in cystic fibrosis (CF) patients and in the setting of prenatal diagnosis. SETTING: A database analysis of sequential screening results seen at the Sheba Medical Center, Israel, between 2001 and 2010. METHODS: We retrospectively analyzed the frequency of D1152H in a large cohort of healthy individuals who were screened as part of a routine prenatal care programme, in individuals referred due to CF-related symptoms and in the setting of prenatal diagnosis. RESULTS: We found one asymptomatic homozygous female and 195 D1152H carriers among 49,940 healthy individuals screened, establishing a carrier rate of 1:255 for this mutation. We detected D1152H in nine of 103 individuals referred due to CF-related symptoms. Four suffered from respiratory symptoms and five from congenital bilateral absence of the vas deferens (CBAVD). During this period D1152H was detected in three pregnancies, two of which were aborted. CONCLUSION: The increased frequency of D1152H in individuals referred due to CF-related symptoms compared with healthy individuals included in the CF carrier screening programme (P < 0.001) clearly indicates that it is a disease-causing mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
180 of mutations Group of mutations 2001 Ashkenazi Jews 7 Group A Non-Ashkenazi Jews 11 Group A þ B Georgian Jews 12 Group A þ B þ T360K/Q359K 9.2004-7.2005 Yemenite Jews 12 Groups A þ B þ I1234V Iraqi Jews 12 Groups A þ B þY1092X 8.2005-12.2007 Iraqi Jews 14 Groups A þ B þY1092X þ 3121-1G-A 1.2008-2010 14 mutations for all 14 Groups A þ B þ C Georgian Jews 15 Groups A þ B þ C þ T360K/Q359K Arabic population 19 Groups A þ B þ C þ D Group A: G542X, W1282X, N1303K, F508del, 3849 þ 10KbC-T, 1717-1G-A, D1152H Group B: W1089X, G85E, 405 þ 1G-A, S549R(T-G) Group C: Y1092X, 3121-1G-A, I1234V Group D: 4010delTATT, S549I, 3120 þ 1Kbdel18.6Kb, 2183AA-G, R75X Between 2005-2008 the Iraqi population was screened for an additional mutation 2751 þ 1insT. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Analysis of the CFTR gene in Turkish cystic fibros... Hum Genet. 1998 Feb;102(2):224-30. Onay T, Topaloglu O, Zielenski J, Gokgoz N, Kayserili H, Camcioglu Y, Cokugras H, Akcakaya N, Apak M, Tsui LC, Kirdar B
Analysis of the CFTR gene in Turkish cystic fibrosis patients: identification of three novel mutations (3172delAC, P1013L and M1028I).
Hum Genet. 1998 Feb;102(2):224-30., [PMID:9521595]

Abstract [show]
In order to determine the spectrum of cystic fibrosis (CF) mutations in the Turkish population, a complete coding region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene including exon-intron boundaries, on 122 unrelated CF chromosomes from 73 Turkish CF families was analysed by denaturing gradient gel electrophoresis and multiplex heteroduplex analysis on MDE gel matrix. In addition to 15 previously reported mutations and 12 polymorphisms, three novel mutations, namely 3172delAC, P1013L and M1028I, were detected. DeltaF508 was found to be present on 18.8% of CF chromosomes. The second most common mutation was 1677delTA, with a frequency of 7.3%, followed by G542X and 2183AA-->G mutations, with frequencies of 4.9%. These four most common mutations in Turkish CF population account for approximately 36% of mutations. This study could only detect 52.5% of disease-causing mutations in this population; 47.5% of CF alleles remain to be identified, reflecting the high molecular heterogeneity of the Turkish population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Other frequent mutations, namely G542X, R560T, S549N or S549I and G551D or R553X, were analysed by the multiplex ARMS method combined with restriction enzyme analysis (Dean et al. 1990; Cutting et al. 1990; Ferrie et al. 1992). Login to comment

[hide] CFTR haplotype analysis reveals genetic heterogene... Am J Hum Genet. 1995 Jun;56(6):1359-66. Rave-Harel N, Madgar I, Goshen R, Nissim-Rafinia M, Ziadni A, Rahat A, Chiba O, Kalman YM, Brautbar C, Levinson D, et al.
CFTR haplotype analysis reveals genetic heterogeneity in the etiology of congenital bilateral aplasia of the vas deferens.
Am J Hum Genet. 1995 Jun;56(6):1359-66., [PMID:7539210]

Abstract [show]
Congenital bilateral aplasia of the vas deferens (CBAVD) was suggested to be a mild form of cystic fibrosis (CF). Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in males with CBAVD revealed that in some males CBAVD is caused by two defective CFTR alleles. The genetic basis of CBAVD in the other males and its association with CF remained unclear. We undertook this study to test the hypothesis of commonality of CBAVD and CF by haplotype analysis, in the CFTR locus, of males suffering from CBAVD and of their families. According to the hypothesis of commonality of CBAVD and CF, two brothers with CBAVD are expected to carry the same two CFTR alleles, while their fertile brothers are expected to carry at least one different allele. Eleven families were studied, of which two families, with unidentified CFTR mutations, did not support this hypothesis. In these families two brothers with CBAVD inherited different CFTR alleles. Their fertile brothers inherited the same CFTR alleles as their brothers with CBAVD. These results provide evidence for genetic heterogeneity in CBAVD. Though in some families CBAVD is associated with two CFTR mutations, we suggest that in others it is caused by other mechanisms, such as mutations at other loci or homozygosity or heterozygosity for partially penetrant CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 The entire studied group of males with CBAVD was tested for 16 CFTR mutations, using DNA-PCR amplification (Saiki et al. 1985, 1988), followed by specific tests as described elsewhere: AF508 (Rommens et al. 1990); W1282X (Shoshani et al. 1992a); G542X, S549R, S549I, and 1717-1G-+A, by direct sequencing of exon 11, using oligonucleotide primers (Zielenski et al. 1991b); N1303K (Osborne et al. 1991); 3849+10Kb C&-T (Highsmith et al. 1994); W1089X and 4010delTATT (Shoshani et al. Login to comment
58 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K. Login to comment
59 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K. Login to comment

[hide] Evaluation of repeat administration of a replicati... Hum Gene Ther. 1995 May;6(5):667-703. Crystal RG, Mastrangeli A, Sanders A, Cooke J, King T, Gilbert F, Henschke C, Pascal W, Herena J, Harvey BG, et al.
Evaluation of repeat administration of a replication deficient, recombinant adenovirus containing the normal cystic fibrosis transmembrane conductance regulator cDNA to the airways of individuals with cystic fibrosis.
Hum Gene Ther. 1995 May;6(5):667-703., [PMID:7578402]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
132 Other C F T R mutations such as AI507 and S549I have a similar pattem of incomplete glycosylation, but other mutations of C F T R code for a C F T R protein glycosylated in a normal fashion (37,46). Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Screening for five mutations detects 97% of cystic... Am J Hum Genet. 1992 Nov;51(5):951-6. Abeliovich D, Lavon IP, Lerer I, Cohen T, Springer C, Avital A, Cutting GR
Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population.
Am J Hum Genet. 1992 Nov;51(5):951-6., [PMID:1384328]

Abstract [show]
To determine the distribution and frequency of cystic fibrosis (CF) mutations in the Israeli population, we have screened 96 patients for 11 relatively common mutations. Five mutations--delta F508, G542X, W1282X, N1303K, and 3849 + 10kb C-->T--were found to account for 97% of the CF alleles in the Ashkenazi Jews. In contrast, of the 11 mutations tested, only delta F508 was detected in Jewish patients of Sephardic or Oriental origin, accounting for 43% of the CF alleles. Four mutations--delta F508, G542X, W1282X, and N1303K--accounted for 55% of the CF alleles in Arab patients. In a pilot screening study, a random sample of 424 Ashkenazi individuals was analyzed for three mutations--delta F508, W1282X, and G542X. Thirteen individuals were detected as heterozygotes (six for delta F508 and seven for W1282X), predicting a heterozygote frequency of 1:29. This is similar to the frequency of carriers in the Caucasian population of northern European ancestry. On the basis of these data, the Ashkenazi population is considered to be a candidate for CF heterozygote screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 The mutations 621 + 1 G-oT, 1717-1 G-oA, S549N, S549I, S549R, G551D, and R553Xwere not foundin our patients. Login to comment