ABCB1 p.Leu531Arg
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 16442101
[PubMed]
Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."
No.
Sentence
Comment
227
G534V and L531R practically eliminated MDR1 expression [119].
X
ABCB1 p.Leu531Arg 16442101:227:10
status: NEW
PMID: 9169612
[PubMed]
Bakos E et al: "Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region."
No.
Sentence
Comment
6
We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure.
X
ABCB1 p.Leu531Arg 9169612:6:29
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Leu531Arg 9169612:38:136
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Leu531Arg 9169612:64:58
status: NEW66 In contrast, two of the mutants, L531R and G534V, gave very low yields of expression ( 10% of the wild-type).
X
ABCB1 p.Leu531Arg 9169612:66:33
status: NEW74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown).
X
ABCB1 p.Leu531Arg 9169612:74:159
status: NEW120 According to our experiments, two amino acid substitutions affecting the ABC-signature region, namely mutations L531R and G534V, led to the formation of unstable MDR1 proteins, which were probably mostly degraded before insertion into the membrane.
X
ABCB1 p.Leu531Arg 9169612:120:112
status: NEW122 Thus the L531R mutation, which introduces an extra positive charge, apparently resulted in a major folding problem for the MDR1, and prevented the formation of a stable molecular architecture even in the Sf9 expression system.
X
ABCB1 p.Leu531Arg 9169612:122:9
status: NEW153 The L531R and G534V mutants were expressed in very low amounts in Sf9 cells, as they apparently could not form stable three-dimensional structures.
X
ABCB1 p.Leu531Arg 9169612:153:4
status: NEW
PMID: 16352426
[PubMed]
Ambudkar SV et al: "The power of the pump: mechanisms of action of P-glycoprotein (ABCB1)."
No.
Sentence
Comment
53
Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily.
X
ABCB1 p.Leu531Arg 16352426:53:25
status: NEW