ABCMdb

ABCC7 p.Val470Met

None has been submitted yet.

Publications

PMID: 12166651 [PubMed] Saito S et al: "Identification of 779 genetic variations in eight genes encoding members of the ATP-binding cassette, subfamily C (ABCC/MRP/CFTR."

No. Sentence Comment

72 A longer Fig. 1a-h. Continued Fig. 1a-h. Continued Fig. 1a-h. Continued Table 2a. Summary of genetic variations detected in the ABCC1 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1661 A/G 2 Intron 2 601 G/A rs215109 3 Intron 2 635 T/C 4 Intron 2 4769 G/del 5 Intron 2 4834 G/A rs1472532 6 Intron 2 10069 T/C 7 Intron 2 11782 A/G rs215096 8 Intron 2 (11965-11984) (T)18-20 9 Intron 4 4302 T/G 10 Intron 4 4394 A/C 11 Intron 4 4524 T/C 12 Intron 5 409 G/A rs1967120 13 Intron 5 1759 C/G rs185005 14 Intron 5 1768 T/C rs246215 15 Intron 6 9045 G/A 16 Intron 7 208 G/A rs2062541 17 Intron 7 (3059-3071) (A)11-13 18 Intron 8 54 C/Ab rs903880 19 Intron 8 (886-889) GAAA/del 20 Intron 8 2420 C/T rs246230 21 Exon 9 16 T/C(Val275Val)c rs246221 22 Exon 10 22 T/C(Asn354Asn) rs35587 23 Intron 10 8 A/G rs35588 2a. Continued No. Location Positiona Genetic variation NCBI SNP ID 24 Intron 10 1940 C/G rs35591 25 Intron 10 1953 T/C rs35592 26 Intron 11 198 C/A 27 Intron 11 784 C/G 28 Intron 12 122 C/G 29 Intron 12 (3138-3148) (A)10-12 30 Intron 12 3197 G/A rs35595 31 Intron 12 3227 C/Tc 32 Intron 13 2060 T/C 33 Intron 13 (2061-2062) C/ins 34 Intron 13 7882 G/A rs35597 35 Intron 13 11776 G/A 36 Intron 13 11824 A/G rs35604 37 Exon 14 7 T/C(Leu562Leu)c rs35605 38 Intron 14 105 C/T rs35606 39 Intron 14 179 A/T 40 Intron 14 321 T/C rs35607 41 Intron 15 2754 G/C rs35620 42 Intron 15 3022 C/T rs35621 43 Intron 15 3980 C/T rs35625 44 Intron 16 219 G/T 45 Intron 16 310 C/T 46 Intron 16 357 G/T rs35626 47 Intron 16 513 G/A rs35627 48 Intron 16 848 A/G rs35628 49 Intron 16 890 G/T 50 Intron 16 1184 C/T rs35629 51 Exon 17 19 C/T(Pro669Pro) rs2301666 52 Intron 17 1171 G/A 53 Intron 17 1332 A/G 54 Exon 18 53 G/A(Arg723Gln) 55 Intron 19 293 T/C rs2074086 56 Intron 19 (3369-3374) (CA)2-3 57 Intron 19 3383 G/C rs207487 58 Intron 20 2730 C/T 59 Intron 20 2789 G/C 60 Intron 20 2919 C/T 61 Intron 20 3024 C/T 62 Intron 20 8716 G/A rs2239996 63 Intron 20 9718 A/C 64 Intron 20 9733 G/C 65 Intron 20 (9895-9896) AT/del 66 Intron 20 9952 G/A 67 Intron 20 11120 A/G 68 Intron 20 11147 G/A 69 Intron 20 (11629-11631) CTT/del 70 Intron 20 11864 C/T 71 Intron 21 3860 G/del 72 Intron 22 878 G/A 73 Intron 22 (4428-4445) (GGGGCT)3-4 74 Intron 23 62 T/C 75 Intron 24 3171 C/T 76 Intron 24 (3349-3368) (T)19-22 77 Intron 24 3369 T/C 78 Intron 24 3584 A/G 79 Intron 24 5322 T/G rs2238475 80 Exon 25 60 G/A(Pro1150Pro) 81 Intron 27 4539 G/A 82 Intron 28 179 G/A rs212011 83 Intron 28 1354 G/A rs212082 84 Intron 28 2150 G/A rs212083 85 Exon 29 36 G/A(Ser1334Ser)c rs2239330 86 Intron 29 1920 G/A rs212087 87 Intron 30 (1708-1714) (T)6-7 88 Intron 31 18 G/Ab rs212088 89 Exon 32 652 C/T(3ЈUTR) 90 Exon 32 910 C/G(3ЈUTR) rs129081 2b. Summary of genetic variations detected in the ABCC2 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Exon 1 77 C/T(5ЈUTR) rs717620 2 Intron 1 413 A/C rs2756103 3 Intron 2 192 T/G 4 Intron 2 1020 G/C 5 Intron 2 3639 C/A 6 Intron 2 3930 A/G 7 Intron 2 3989 C/T 8 Intron 2 4078 T/C rs2145852 9 Intron 2 4171 C/T rs2756107 10 Intron 2 4257 G/A rs2145853 11 Intron 2 4436 C/G rs2180990 12 Intron 2 5227 A/G 13 Intron 2 5373 A/G 14 Intron 2 5538 G/T 15 Intron 3 772 A/T rs2073336 16 Intron 3 1145 C/T rs2804400 17 Intron 7 1658 G/T rs2756109 18 Exon 10 40 G/A(Val417Ile) rs2273697 19 Intron 11 1672 T/A 20 Intron 12 148 A/G rs2073337 21 Intron 13 180 G/C 22 Intron 13 1497 T/C rs2756114 23 Intron 15 169 T/C 24 Intron 15 949 A/G 25 Intron 15 984 A/C 26 Intron 16 4059 C/G 27 Intron 19 10899 G/A 28 Exon 22 51 G/A(Ser978Ser) 29 Intron 23 56 C/T 30 Intron 23 432 G/A 31 Intron 23 734 G/A 32 Intron 23 801 T/G 33 Intron 26 154 T/C 34 Intron 27 124 C/G 35 Exon 28 52 A/C(Lys1299Gln) 36 Exon 28 84 C/T(Tyr1309Tyr) 37 Exon 28 129 C/T(Ile1324Ile) 38 Intron 29 154 A/G 39 Intron 30 91 T/C 40 Intron 31 170 A/G 41 3ЈFlanking 371 C/T rs12826 ABCC2, ATP-binding cassette, subfamily C, member2 Table 2a. Continued No. Location Positiona Genetic variation NCBI SNP ID 91 Exon 32 975 T/A(3ЈUTR) rs212090 92 3ЈFlanking 158 G/A 93 3ЈFlanking (187-199) (T)11-13 94 3ЈFlanking 378 T/C rs212091 95 3ЈFlanking 2227 G/A ABCC1, ATP-binding cassette, subfamily C, member1; NCBI, National Center for Biotechnology Information; SNP, single-nucleotide polymorphism; UTR, untranslated region; del, deletion; ins, insertion a For SNPs in the 5Ј flanking region, intron region, or 3Ј flanking region, nucleotide positions are counted from the first intronic nucleotide at the exon/intron junction (for SNPs in the exon region, nucleotide positions are counted from the first exonic nucleotide at the exon/intron junction) b SNPs previously reported by Conrad et al. (2001) c SNPs previously reported by Ito et al. (2001) 2c. Summary of genetic variations detected in the ABCC3 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1064 C/T 2 5ЈFlanking -(827-820) (C)7-8 3 Intron 1 1226 T/G 4 Intron 1 (1389-1399) (A)10-12 5 Intron 1 2070 C/T 6 Intron 1 4378 A/G rs1548529 7 Intron 1 4477 G/A 8 Intron 1 6189 T/C 9 Intron 2 268 G/A 10 Intron 2 376 G/C 11 Intron 2 446 C/T 12 Intron 3 166 G/A rs2301836 13 Intron 5 206 G/A rs739923 14 Intron 6 432 G/C rs733393 15 Intron 6 546 G/A rs733392 16 Intron 7 1132 C/G rs1978153 17 Intron 7 1537 C/T rs2301837 18 Intron 8 2323 C/G 19 Intron 12 85 C/del 20 Intron 14 257 T/C rs879459 21 Intron 18 303 G/A rs2240801 22 Intron 19 1581 C/T 23 Intron 20 29 C/T rs2072365 24 Intron 20 53 G/A rs2072366 25 Exon 22 180 C/T(Gly1013Gly) 26 Intron 23 1053 G/A rs2240802 27 Intron 24 84 C/T rs967935 28 Exon 27 135 C/T(His1314His) rs2277624 29 Intron 28 412 T/C rs872793 30 Intron 30 1979 C/G 31 Intron 30 2340 A/G 32 Exon 31 34 A/G(Glu1503Glu) rs1051640 33 3ЈFlanking (555-558) AAGA/del 34 3ЈFlanking 1455 G/A 35 3ЈFlanking (1650-1659) (A)9-11 ABCC3, ATP-binding cassette, subfamily C, member3 Table 2d. Summary of genetic variations detected in the ABCC4 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -644 C/T 2 5ЈFlanking -527 C/G rs869951 3 Exon 1 67 C/T(5ЈUTR) 4 Intron 1 (864-865) CT/del 5 Intron 1 21255 A/G 6 Intron 1 21503 T/C 7 Intron 1 21900 C/G 8 Intron 1 22005 C/T 9 Intron 1 (22256-22264) (T)8-9 10 Intron 1 27784 C/G 11 Intron 1 27821 A/T 12 Intron 1 27837 A/G 13 Intron 1 27880 C/T 14 Intron 1 40310 A/T 15 Intron 1 40372 G/A 16 Intron 1 40413 G/A 17 Intron 1 40958 A/G 18 Intron 1 50060 G/A 19 Intron 2 181 G/T 20 Intron 2 254 G/A 21 Intron 2 290 T/C 22 Intron 2 543 T/C 23 Intron 3 557 G/A 24 Intron 3 718 G/A 25 Intron 3 801 G/A 26 Intron 3 1022 T/C 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 27 Intron 3 1471 A/G 28 Intron 3 1490 G/A 29 Intron 3 (1833-1834) G/ins 30 Intron 3 1870 G/A 31 Intron 3 1927 G/A 32 Intron 3 1970 A/T 33 Intron 3 2039 T/C 34 Intron 3 (2067-2068) CTTT/ins 35 Intron 3 3563 G/A 36 Intron 3 3696 C/G 37 Intron 3 4093 T/C 38 Intron 3 4097 T/del 39 Intron 3 9724 A/G 40 Intron 3 9988 G/A 41 Intron 3 10952 A/G 42 Intron 3 11125 A/G 43 Intron 3 11244 C/del 44 Intron 3 11916 A/del 45 Intron 3 12047 A/G 46 Exon 4 205 T/G(Cys171Gly) 47 Intron 4 (412-414) GTT/del 48 Intron 4 -(9757-9756) T/ins 49 Intron 4 -6373 C/G 50 Intron 4 -6267 T/C 51 Intron 4 -6097 T/C 52 Intron 4 -6057 C/T 53 Intron 4 -5295 A/G 54 Intron 4 -803 C/T 55 Intron 4 -745 C/T rs1678400 56 Intron 4 -736 C/T 57 Intron 4 -728 C/T 58 Intron 4 -624 A/C 59 Intron 4 -470 C/T 60 Intron 4 -411 G/A 61 Intron 4 -323 C/T 62 Intron 4 -246 A/G 63 Intron 4 -199 C/T 64 Intron 4 -108 C/T rs899497 65 Intron 5 50 C/T rs899496 66 Intron 5 73 C/T 67 Intron 5 403 G/A 68 Intron 5 537 T/A rs943288 69 Intron 5 559 G/A rs873706 70 Intron 5 749 G/A rs873705 71 Intron 5 750 C/T rs899495 72 Intron 5 937 G/C 73 Intron 5 949 A/C rs2389203 74 Intron 5 965 G/C rs1678403 75 Exon 6 48 C/T(Ile223Ile) rs899494 76 Intron 6 150 C/T 77 Intron 6 158 C/T rs2389204 78 Intron 6 (380-381) AT/ins 79 Intron 6 1400 T/G rs2274410 80 Intron 6 1474 G/A rs2274409 81 Intron 7 80 G/A rs2274408 82 Intron 7 894 A/T 83 Exon 8 1 G/T(Lys302Asn) rs2274407 84 Exon 8 40 G/A(Arg317Arg) rs2274406 85 Exon 8 58 G/A(Ser323Ser) rs2274405 86 Intron 8 82 C/G 87 Intron 8 100 C/T 88 Intron 8 5212 A/T 89 Intron 8 5444 T/G 90 Intron 8 8969 A/G 91 Intron 8 9106 T/C 92 Intron 8 9189 G/A rs1751021 93 Intron 8 9412 G/A 94 Intron 9 70 T/C rs2274403 95 Intron 9 116 A/G 96 Intron 9 1384 T/C 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 97 Intron 9 1428 A/G rs1751015 98 Intron 9 1459 A/G 99 Intron 9 1485 C/A rs1751014 100 Intron 9 1632 C/A 101 Intron 9 3630 G/del 102 Intron 9 3830 C/T 103 Intron 9 3940 C/T 104 Intron 9 4023 G/A rs1678374 105 Intron 10 1411 A/G rs1557069 106 Intron 10 1504 G/A 107 Intron 11 171 C/A rs2148529 108 Intron 11 1233 T/C rs1564351 109 Intron 11 1293 G/A rs1751008 110 Intron 11 1817 G/C 111 Intron 11 3261 C/T rs1887163 112 Intron 11 3322 C/A rs1887162 113 Intron 11 3342 T/C 114 Intron 11 3377 T/C 115 Intron 11 (3610-3625) (A)15-17 116 Intron 11 3737 A/G 117 Intron 11 6953 C/A 118 Intron 13 91 G/A rs1751005 119 Intron 13 118 C/T rs2296653 120 Intron 13 280 G/A rs1678405 121 Intron 13 349 T/G rs1073500 122 Intron 13 373 A/G rs2009772 123 Intron 13 386 G/A rs2478461 124 Intron 13 442 G/C 125 Intron 13 459 T/C 126 Intron 13 633 G/A 127 Intron 13 645 G/T 128 Intron 13 3092 C/T rs1751003 129 Intron 13 3306 A/C 130 Intron 13 6722 G/A rs1729786 131 Intron 14 252 A/G 132 Intron 15 124 C/T 133 Intron 15 219 G/A rs1729770 134 Intron 15 1016 A/G rs1038138 135 Intron 15 1552 C/T 136 Intron 16 107 T/C rs1729764 137 Intron 16 157 G/A 138 Intron 17 329 T/C 139 Exon 18 56 G/A(Glu757Lys) 140 Intron 19 5440 T/C rs1729788 141 Intron 19 7202 T/del 142 Intron 19 7445 T/C 143 Intron 19 8337 T/C rs1471481 144 Intron 19 9018 A/G 145 Intron 19 9127 G/T rs899498 146 Intron 19 10304 C/A rs1479390 147 Intron 19 11388 A/G 148 Intron 19 11646 T/del 149 Intron 19 13517 A/T 150 Intron 19 19989 A/T rs997777 151 Intron 19 21033 G/A 152 Intron 19 21095 A/T 153 Intron 19 21582 G/A rs2619313 154 Intron 19 21634 C/T 155 Intron 19 21715 C/T 156 Intron 19 23090 G/A 157 Intron 19 24297 A/G 158 Intron 19 25947 C/A 159 Intron 19 30193 A/C 160 Intron 19 33424 A/G rs1189428 161 Intron 19 33474 T/C rs1189429 162 Intron 19 34901 T/G rs1564353 163 Intron 19 34916 G/T rs1564354 164 Intron 19 35277 T/C rs1564355 165 Intron 19 36938 C/G 166 Intron 19 37322 C/T 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 167 Intron 19 (38361-38362) T/ins 168 Intron 19 38746 T/C 169 Intron 19 41603 T/C rs1678342 170 Intron 19 42343 C/T 171 Intron 19 44733 A/del 172 Intron 19 45056 T/G rs1678394 173 Intron 20 (405-419) (T)13-15 174 Intron 20 (637-648) (A)12-13 175 Intron 20 842 T/del 176 Intron 20 843 T/C 177 Intron 20 1347 T/del 178 Intron 20 1614 A/G rs1729748 179 Intron 20 2222 G/A rs1678395 180 Intron 20 4115 G/A rs1628382 181 Intron 20 9851 T/G rs1678363 182 Intron 20 10233 C/T rs1729775 183 Intron 20 12141 T/G rs1630807 184 Intron 20 12153 G/C rs1751059 185 Intron 20 (14553-14567) (A)13-15 186 Intron 20 15487 C/T 187 Intron 20 15698 G/C rs1678354 188 Intron 20 15951 C/A rs1729761 189 Intron 20 16152 T/C rs1729760 190 Intron 20 16161 T/C 191 Intron 20 16185 A/G rs1729759 192 Intron 20 30891 C/T 193 Intron 20 30984 C/T rs1189434 194 Intron 20 31180 G/A 195 Intron 20 31283 A/del 196 Intron 20 31526 A/G rs1189435 197 Intron 20 32572 A/C rs1189437 198 Intron 21 404 C/T rs1189438 199 Intron 21 428 G/A rs1189439 200 Intron 21 2016 C/T rs1751052 201 Intron 21 3703 G/A rs1678362 202 Intron 21 3898 G/C rs1751050 203 Intron 21 3902 C/T rs1624638 204 Intron 21 4204 A/T 205 Intron 21 4336 T/C rs943290 206 Intron 21 4471 C/T rs943289 207 Intron 21 4527 A/G rs1729755 208 Intron 21 7071 C/A rs1751042 209 Exon 22 26 A/G(Leu904Leu) rs1678339 210 Intron 22 1026 A/C 211 Exon 23 38 C/T(Phe948Phe) rs1189466 212 Intron 23 377 A/G 213 Intron 23 395 G/A rs1189465 214 Intron 23 602 G/A rs1189464 215 Intron 24 99 A/G rs2274401 216 Intron 24 1096 G/A rs1189462 217 Intron 25 128 G/A rs1189461 218 Intron 25 4122 C/G/T 219 Intron 25 4422 G/C rs1189457 220 Intron 25 4936 A/C rs1678365 221 Intron 25 5251 A/G rs1751036 222 Intron 25 5428 G/A rs1678409 223 Intron 25 6418 C/A 224 Intron 25 8764 T/C rs1751035 225 Intron 25 (8765-8775) (T)5-11 226 Exon 26 138 A/G(Lys1116Lys) rs1751034 227 Intron 26 67 G/C 228 Intron 26 100 T/G rs1751033 229 Intron 26 (101-109) (T)8-9 230 Intron 26 362 G/A rs931110 231 Intron 26 463 T/C rs922522 232 Intron 26 591 T/C rs931111 233 Intron 26 7716 G/A rs1189444 234 Intron 26 7816 G/A rs1189445 235 Intron 26 7845 A/G rs1189446 236 Intron 26 9266 A/G rs1189449 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 237 Intron 27 7469 G/A rs1151471 238 Intron 28 391 T/del 239 Intron 29 2569 C/T 240 Intron 29 7820 C/T 241 Intron 30 6269 A/G 242 Intron 30 6320 C/T 243 Intron 30 6474 A/G 244 Intron 30 6519 C/T 245 Intron 30 6574 C/T 246 Intron 30 6680 A/G 247 Intron 30 -704 A/C 248 Intron 30 -228 A/G 249 Intron 30 -(14-5) (T)9-10 250 Exon 31 146 G/T(3ЈUTR) 251 3ЈFlanking 173 A/G 252 3ЈFlanking (430-440) (A)10-11 253 3ЈFlanking 556 G/A 254 3ЈFlanking 741 T/C rs1059751 255 3ЈFlanking 1144 T/C 256 3ЈFlanking 1426 A/T 257 3ЈFlanking 1454 C/T rs1059762 ABCC4, ATP-binding cassette, subfamily C, member4 Table 2e. Summary of genetic variations detected in the ABCC5 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Intron 1 628 G/C 2 Intron 1 1834 C/T 3 Intron 1 3055 A/del 4 Intron 2 -20280 T/C 5 Intron 2 -20260 A/T 6 Intron 2 -19204 C/T 7 Intron 2 -19043 G/A 8 Intron 2 -18824 A/G 9 Intron 2 -18807 G/A 10 Intron 2 -(18735-18734) A/ins 11 Intron 2 -16898 C/T rs2292997 12 Intron 2 -15903 G/A 13 Intron 2 -15901 C/T 14 Intron 2 -15847 G/A 15 Intron 2 -15605 C/T 16 Intron 2 -13571 G/A 17 Intron 2 -13402 G/T 18 Intron 2 -13325 G/C 19 Intron 2 -7293 C/T 20 Intron 5 374 C/T 21 Intron 5 1490 T/C rs939338 22 Intron 5 (2212-2213) CT/del 23 Intron 5 3283 C/T 24 Intron 5 3469 C/T 25 Intron 5 4411 G/C rs939337 26 Intron 5 4630 C/T rs2313212 27 Intron 7 28 G/A rs2293001 28 Intron 7 443 C/T 29 Intron 7 458 T/G 30 Exon 9 38 C/T(Ala395Ala) rs2271938 31 Intron 9 176 A/G 32 Intron 9 214 G/T 33 Intron 10 703 T/C 34 Intron 10 3580 A/G 35 Intron 10 3655 G/A 36 Intron 10 3854 T/C 37 Intron 10 5040 C/T 38 Intron 10 5062 C/T rs869335 39 Intron 10 5316 C/T 40 Intron 11 213 A/G rs869417 2e. Continued No. Location Positiona Genetic variation NCBI SNP ID 41 Exon 12 21 T/C(Cys594Cys) rs939336 42 Intron 12 234 G/A 43 Intron 12 300 A/G 44 Intron 12 318 A/G 45 Intron 12 1545 C/T 46 Intron 13 20 T/C 47 Intron 14 13 C/T rs2271937 48 Intron 14 76 C/T rs1879257 49 Intron 14 278 A/G 50 Intron 15 117 A/C rs2292999 51 Intron 16 (1654-1663) (T)9-10 52 Intron 16 1664 A/T 53 Intron 17 20 T/G 54 Intron 18 232 C/T 55 Intron 19 249 G/A 56 Intron 20 846 G/A 57 Intron 20 1154 A/del 58 Intron 22 (1424-1425) AT/ins 59 Intron 22 1799 T/C rs2280392 60 Intron 23 50 C/G rs1016752 61 Intron 23 1279 G/A rs2292998 62 Intron 24 132 A/G 63 Intron 24 -874 A/G 64 Intron 24 -630 G/A 65 Intron 24 -102 G/C 66 Exon 25 120 C/T(Leu1208Leu) 67 Intron 26 263 C/T 68 Intron 26 -3717 G/A rs2037379 69 Intron 26 -3257 T/C 70 Intron 27 873 G/A 71 Intron 29 (2733-2734) TGTCCAAAGGAAGGACACG/ins 72 Intron 29 2959 A/G 73 Intron 29 4020 G/A 74 Exon 30 684 G/A(3ЈUTR) 75 Exon 30 947 C/T(3ЈUTR) 76 Exon 30 (1145-1160) (TC)6-8(3ЈUTR) 77 Exon 30 1345 A/G(3ЈUTR) rs562 78 3ЈFlanking 4 A/C 79 3ЈFlanking 1729 C/T rs2313217 80 3ЈFlanking 1911 C/T rs1533684 81 3ЈFlanking 1958 A/G rs1000002 82 3ЈFlanking 2008 C/del 83 3ЈFlanking 2052 A/G 84 3ЈFlanking 2238 G/A rs1533683 85 3ЈFlanking 2845 A/G rs1533682 ABCC5, ATP-binding cassette, subfamily C, member5 Table 2f. Summary of genetic variations detected in the CFTR gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -834 T/G 2 5ЈFlanking -729 T/del 3 Exon 1 125 G/C(5ЈUTR) rs1800501 4 Intron 1 6200 G/A rs2283054 5 Intron 1 7538 C/A 6 Intron 1 9203 T/C rs885993 7 Intron 1 13519 T/C rs2237721 8 Intron 1 14110 T/del 9 Intron 1 14293 C/del 10 Intron 1 14316 C/G 11 Intron 1 14433 G/A 12 Intron 1 14824 G/C 13 Intron 1 23401 C/G 14 Intron 3 879 C/A 2f. Continued No. Location Positiona Genetic variation NCBI SNP ID 15 Intron 3 922 G/C 16 Intron 3 933 C/T 17 Intron 3 2632 A/C rs980574 18 Intron 3 13704 A/del 19 Intron 3 13758 A/G 20 Intron 3 21578 G/A rs1429566 21 Intron 4 240 T/del 22 Intron 4 376 A/G 23 Intron 4 586 T/C 24 Intron 4 1089 G/A rs957461 25 Intron 4 1101 T/A rs213942 26 Intron 4 1615 C/T 27 Intron 4 1946 T/C 28 Intron 6 783 A/G 29 Intron 6 (1104-1131) (GATT)6-7 30 Intron 7 (731-732) T/ins 31 Intron 7 1434 T/C 32 Intron 7 1481 A/G rs213935 33 Intron 8 752 A/G rs2237725 34 Intron 8 1109 G/A 35 Intron 8 1312 T/del 36 Intron 9 (6499-6520) (TG)11-12 b 37 Intron 10 395 G/A rs1820871 38 Intron 10 2119 T/G 39 Intron 10 2406 G/A rs213946 40 Exon 11 16 G/A(Val470Met)c rs213950 41 Intron 11 3867 A/del 42 Intron 11 11844 A/del 43 Intron 11 12144 T/C rs2082056 44 Intron 11 20975 G/A 45 Intron 11 21152 A/G rs213955 46 Intron 11 21297 G/A rs213956 47 Intron 11 27057 G/A 48 Intron 11 27131 T/del 49 Intron 12 1280 G/A rs213963 50 Intron 12 1449 A/G rs213964 51 Intron 12 1650 T/A rs213965 52 Intron 13 152 T/A 53 Intron 13 287 T/C 54 Intron 14 1826 A/G rs117243 55 Intron 15 (85-86) AT/del 56 Intron 15 106 T/A 57 Intron 15 3267 T/G rs213976 58 Intron 15 3333 T/G rs213977 59 Intron 15 3341 A/C 60 Intron 15 5556 A/T rs2246450 61 Intron 15 5919 C/A rs2106155 62 Intron 15 6282 A/T rs2213958 63 Intron 17 2479 A/C rs2299445 64 Intron 18 -81 A/del 65 Intron 19 751 A/G 66 Intron 19 820 T/C 67 Intron 20 1011 G/T rs213980 68 Intron 21 1532 T/del 69 Intron 21 1607 C/T rs2237726 70 Intron 21 4244 G/A rs213985 71 Intron 21 11260 T/C 72 Intron 22 (130-131) AT/del 73 Intron 23 1837 A/del 74 Intron 24 (7100-7112) (T)12-14 75 Intron 25 237 C/T 76 Exon 27 115 C/T(Arg1453Trp) 77 Exon 27 334 T/del(3ЈUTR) CFTR, Cystic fibrosis transmembrane conductance regulator b SNP previously reported by Chu et al. (1993) c SNP previously reported by Cuppens et al. (1998) 2g. Summary of genetic variations detected in the ABCC8 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1099 T/C 2 5ЈFlanking -(424-422) CAC/del 3 Intron 1 382 G/C rs985136 4 Intron 1 1212 A/G 5 Exon 2 59 T/C(Pro69Pro)b rs1048099 6 Intron 2 1003 C/A rs2283253 7 Intron 2 1253 C/T rs2283254 8 Intron 2 1382 T/C rs2283255 9 Intron 2 2371 T/A 10 Intron 3 1957 C/T 11 Intron 3 (2088-2089) CCA/ins 12 Intron 3 2204 G/A rs2283257 13 Intron 3 2286 A/G 14 Intron 3 2312 C/G 15 Intron 3 2356 A/G 16 Intron 3 2359 A/C 17 Intron 3 2370 G/A 18 Intron 3 2382 A/G 19 Intron 3 4910 G/A 20 Intron 3 4969 A/G 21 Intron 3 5003 C/G 22 Intron 3 5019 A/C 23 Intron 4 14 C/Tb rs2301703 24 Intron 4 187 G/A rs2301704 25 Intron 4 204 G/C 26 Intron 4 254 G/A 27 Intron 4 357 G/C 28 Intron 5 92 G/A rs2074317 29 Intron 5 801 C/T rs886289 30 Intron 5 802 A/G rs886290 31 Intron 6 87 A/G rs886291 32 Intron 6 4205 G/A rs2237975 33 Intron 6 5519 A/C rs2237976 34 Intron 6 5575 G/C rs2237977 35 Intron 6 6587 C/T rs2073585 36 Intron 6 6747 C/T rs2073586 37 Intron 7 348 A/C rs2057661 38 Intron 8 28 G/A rs1800850 39 Intron 8 4015 T/G rs886292 40 Intron 9 191 A/G rs2073587 41 Intron 10 1963 T/G rs2283261 42 Intron 10 2047 T/C rs886293 43 Intron 10 2724 A/G rs2237979 44 Intron 10 2938 G/C rs2237980 45 Intron 10 3094 T/del 46 Intron 10 3368 A/G rs2237981 47 Intron 10 8897 C/T 48 Intron 11 308 G/A 49 Intron 11 1171 G/A rs2074308 50 Exon 12 7 G/A(Val560Met) 51 Exon 12 15 C/T(His562His) rs1799857 52 Intron 12 356 G/T 53 Intron 12 934 G/T 54 Intron 12 1370 C/G rs2283262 55 Exon 14 25 G/A(Lys649Lys) rs1799858 56 Intron 15 412 C/T 57 Intron 15 688 A/G 58 Intron 15 709 C/Tc rs1799854 59 Intron 16 4464 G/A rs2237988 60 Intron 16 4574 T/C 61 Intron 16 5011 C/T rs2299638 62 Intron 16 6138 A/T rs929235 63 Intron 16 7608 C/G rs2299641 64 Intron 16 7730 G/A rs2299642 65 Intron 16 7818 C/G rs916828 66 Intron 16 8369 T/C rs2237991 67 Intron 16 9708 T/G rs2074315 68 Intron 17 651 A/G rs2234773 69 Intron 17 692 A/G 70 Intron 17 1541 C/T 2g. Continued No. Location Positiona Genetic variation NCBI SNP ID 71 Intron 18 580 C/T 72 Intron 18 658 C/Tb 73 Intron 18 660 T/Cb 74 Intron 19 93 T/C 75 Intron 19 123 T/C 76 Intron 19 219 C/T 77 Intron 19 845 C/T rs2074309 78 Intron 20 338 A/G rs2355017 79 Exon 21 10 C/T(Leu829Leu) 80 Intron 21 192 C/del 81 Intron 23 17 A/G rs2106865 82 Intron 23 67 C/T 83 Intron 23 581 T/C rs1319447 84 Intron 26 268 G/C rs2077654 85 Intron 26 308 C/T rs2077655 86 Intron 26 348 A/G rs2077144 87 Intron 26 613 A/G rs739688 88 Intron 26 807 G/A 89 Intron 26 834 G/C rs2073583 90 Intron 28 (118-121) AAAA/del 91 Intron 28 1348 G/A rs2067043 92 Intron 29 1253 G/T 93 Intron 29 1589 A/G 94 Intron 29 2322 G/A rs2074310 95 Intron 29 2348 T/C rs2074311 96 Intron 29 2418 C/T rs2074312 97 Intron 29 2494 C/A 98 Intron 29 2735 C/T 99 Intron 30 386 C/T 100 Exon 31 66 G/A(Arg1273Arg)c rs1799859 101 Exon 33 117 T/G(Ser1369Ala) rs757110 102 Intron 33 93 G/T 103 Intron 33 358 C/T 104 Intron 33 446 T/C rs757111 105 Intron 33 959 T/Cd rs759689 106 Intron 38 54 G/C 107 Intron 38 466 C/del 108 Intron 38 529 A/G ABCC8, ATP-binding cassette, subfamily C, member8 b SNPs previously reported by Nestorowicz et al. (1998) c SNPs previously reported by Inoue et al. (1996) d SNP previously reported by Goksel et al. (1998) Table 2h. Summary of genetic variations detected in the ABCC9 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Intron 2 -321 T/C rs870134 2 Intron 2 -266 A/G rs870135 3 Intron 3 38 C/A 4 Intron 3 305 T/A rs2176394 5 Intron 3 320 A/G 6 Intron 3 631 G/C 7 Intron 3 8644 A/G 8 Intron 4 757 A/C 9 Intron 4 1022 A/C 10 Intron 5 -1217 A/G 11 Intron 5 -1208 A/G rs1344569 12 Intron 5 -180 A/G rs1517276 13 Intron 6 (100-106) (T)8-9 14 Intron 6 1347 A/del 15 Intron 6 1618 G/A rs2418021 16 Intron 6 1835 C/Tb 17 Intron 7 407 T/G 18 Intron 7 423 C/T 19 Intron 8 743 A/T 20 Intron 8 850 T/G 2h. Continued No. Location Positiona Genetic variation NCBI SNP ID 21 Intron 8 1360 C/T rs1421602 22 Intron 9 585 A/T 23 Intron 9 1394 G/C 24 Intron 11 1035 A/G rs704217 25 Intron 12 908 T/C rs704215 26 Intron 12 1113 T/C rs1914361 27 Intron 12 1167 G/A rs2292771 28 Intron 12 1195 A/G rs2292772 29 Intron 12 2123 G/A 30 Intron 12 2622 G/A rs704212 31 Intron 12 (2653-2656) TAAC/del 32 Intron 12 2756 G/A rs2032775 33 Intron 13 (3043-3044) CTCTTT/ins or CT/ins 34 Intron 13 4877 A/C rs1283802 35 Intron 13 4887 A/G rs1356368 36 Intron 14 85 T/A 37 Intron 14 275 T/C 38 Intron 14 453 T/C 39 Intron 14 3709 G/A 40 Intron 14 3813 C/T 41 Intron 14 4000 A/del 42 Intron 14 5522 T/A rs1492138 43 Intron 14 5535 T/G rs704205 44 Intron 16 1466 A/C 45 Intron 16 5357 T/G 46 Intron 16 7395 A/G rs697252 47 Intron 16 7407 C/T rs768314 48 Intron 17 970 A/T rs704194 49 Intron 17 (1358-1368) (T)10-11 50 Intron 18 119 C/T rs704193 51 Intron 18 773 T/C rs704192 52 Intron 18 865 A/G rs704191 53 Intron 20 98 G/A 54 Intron 20 173 C/T rs704189 55 Intron 22 28 A/C rs2307024 56 Intron 22 194 G/del 57 Intron 22 1370 C/T 58 Intron 22 1487 C/G 59 Intron 22 3148 T/G rs1283822 60 Intron 23 (455-462) AATTAGAA/del 61 Intron 23 1221 A/G rs829080 62 Intron 23 1976 C/A rs829079 63 Intron 24 (460-465) TTTAAAA/TTTTAA 64 Intron 24 595 A/G rs2307025 65 Intron 26 -150 T/G rs1643235 66 Intron 27 1628 C/T rs704179 67 Intron 27 1770 C/G rs704178 68 Intron 27 1976 A/T rs704177 69 Intron 28 -926 G/A rs2112080 70 Intron 29 667 T/C rs1283811 71 Intron 29 1072 A/C rs1283810 72 Intron 29 2692 T/del 73 Intron 29 2959 T/C rs1873638 74 Intron 29 5464 G/A 75 Intron 29 -1830 A/T 76 Intron 31 102 G/A rs2638441 77 Intron 33 877 A/G 78 Intron 33 1069 T/C rs2216525 79 Intron 36 (1270-1281) (T)11-12 80 Intron 37 533 C/G rs829060 81 3ЈFlanking 197 T/G ABCC9, ATP-binding cassette, subfamily C, member9 b SNP previously reported by Iwasa et al. (2001) 3. Login to comment

PMID: 18716917 [PubMed] George Priya Doss C et al: "A novel computational and structural analysis of nsSNPs in CFTR gene."

No. Sentence Comment

125 The nsSNPs which were predicted to be Table 1 List of nsSNPs that were predicted to be deleterious by SIFT and PolyPhen SNPs ID Alleles AA change Tolerance index PSIC rs1800072 G/A V11C 1.00 0.150 rs1800073 C/T R31C 0.18 2.288 rs1800074 A/T D44V 0.01 2.532 rs1800076 G/A R75Q 0.03 1.754 rs1800078 T/C L138P 0.01 2.192 rs35516286 T/C I148T 0.41 1.743 rs1800079 G/A R170H 0.05 1.968 rs1800080 A/G S182G 0.03 1.699 rs1800086 C/G T351S 0.30 1.600 rs1800087 A/C Q353H 0.03 2.093 rs4727853 C/A N417K 1.00 0.015 rs11531593 C/A F433L 0.65 0.694 rs1800089 C/T L467F 0.15 1.568 rs213950 G/A V470M 0.17 1.432 rs1800092 C/A/G I506M 0.00 1.574 rs1801178 A/G I507V 0.38 0.314 rs1800093 T/G F508C 0.00 3.031 rs35032490 A/G K532E 1.00 1.525 rs1800097 G/A V562I 0.13 0.345 rs41290377 G/C G576A 0.33 1.262 rs766874 C/T S605F 0.03 2.147 rs1800099 A/G S654G 0.03 1.611 rs1800100 C/T R668C 0.01 2.654 rs1800101 T/C F693L 0.61 0.895 rs1800103 A/G I807M 0.01 1.554 rs1800106 T/C Y903H 0.52 0.183 rs1800107 G/T S909I 0.10 1.624 rs1800110 T/C L967S 0.07 1.683 rs1800111 G/C L997F 0.24 1.000 rs1800112 T/C I1027T 0.03 1.860 rs1800114 C/T A1067V 0.04 1.542 rs36210737 T/A M1101K 0.05 2.637 rs35813506 G/A R1102K 0.52 1.589 rs1800120 G/T R1162L 0.00 2.038 rs1800123 C/T T1220I 0.22 0.059 rs34911792 T/G S1235R 0.45 1.483 rs11971167 G/A D1270N 0.12 1.739 rs4148725 C/T R1453W 0.00 2.513 Highly deleterious by SIFT and damaging by PolyPhen are indicated as bold deleterious in causing an effect in the structure and function of the protein by SIFT, PolyPhen and Pupasuite correlated well with experimental studies (Tsui 1992; Ghanem et al. 1994; Bienvenu et al. 1998) (Table 3). Login to comment

PMID: 20233062 [PubMed] van de Vosse E et al: "Distribution of CFTR variations in an Indonesian enteric fever cohort."

No. Sentence Comment

97 (%) 2-sided P value Of case patients (n p 116) Of control subjects (n p 322) IVS6a GATTn repeat at 9 nt before exon 6b; rs3034763 .40b GATT7 128 (57.1) 379 (60.4) GATT6 96 (42.9) 248 (39.5) GATT4 0 1 (0.2) IVS8 TGn repeat at 16 nt before exon 9; rs4646205 .17 c TG10 7 (3.0) 7 (1.2) TG11 110 (47.8) 298 (50.0) TG12 113 (49.1) 285 (47.8) TG13 0 (0) 5 (0.8) TG15 0 (0) 1 (0.2) IVS8 Tn repeat at 6 nt before exon 9; rs1805177 NDd T5 1 (0.4) 8 (1.3) T7 222 (96.5) 581 (97.5) T9 7 (3.0) 7 (1.2) 1408G1A in exon 10 leading to V470M; rs213950 .36 G 126 (56.3) 380 (59.7) A 98 (43.8) 256 (40.3) 2562T1G in exon 14a, silent; rs1042077 .78 T 138 (60.0) 392 (61.1) G 92 (40.0) 250 (38.9) 4056G1C in exon 22, leading to Q1352H; NA .56 G 220 (94.8) 602 (93.8) C 12 (5.2) 40 (6.2) 4389G1A in exon 24, silent; rs1800136 ND d G 220 (94.8) 617 (96.1) A 12 (5.2) 25 (3.9) NOTE. NA, not available; ND, not determined; SNP, single-nucleotide polymorphism. Login to comment
107 The 7 polymorphisms that were detected more frequently were a IVS6a GATT repeat polymorphism 9 base pairs (bp) upstream of exon 6b, a variation in the number of TG repeats 16 bp upstream of exon 9, an adjacent variation in the number of Ts 6 bp upstream of exon 9, the common 1408G1A coding single-nucleotide polymorphism (SNP) (leading to V470M), the silent SNP 2562T1G, the 4056G1C mutation (leading to Q1352H), and the silent SNP 4389G1A (Table 3). Login to comment
116 (%) 2-sided P value Of case patients (n p 116) Of control subjects (n p 322) IVS6a GATTn .59a GATT6GATT6 23 (20.5) 51 (16.2) GATT6GATT7 50 (44.6) 146 (46.5) GATT7GATT7 39 (34.8) 116 (36.9) GATT4GATT7 0 (0) 1 (0.3) IVS8 TGn .04b TG11TG11 31 (27.0) 72 (24.2) TG11TG12 45 (39.1) 150 (50.3) TG12TG12 32 (27.8) 64 (21.5) Other 7 (6.1) 12 (4.0) IVS8 Tn .45b T7T7 107 (93.0) 283 (95.0) T7T9 7 (6.1) 7 (2.3) Other 1 (0.9) 8 (2.7) 1408G1A (V470M) .55 GG 39 (34.8) 118 (37.1) GA 48 (42.9) 144 (45.3) AA 25 (22.3) 56 (17.6) 2562T1G .06 b TT 49 (42.6) 124 (38.6) TG 40 (34.8) 144 (44.9) GG 26 (22.6) 53 (16.5) 4056G1C (Q1352H) .44b GG 105 (90.5) 282 (87.9) GC 10 (8.6) 38 (11.8) CC 1 (0.9) 1 (0.3) 4389G1A .39 GG 104 (89.7) 296 (92.2) GA 12 (10.3) 25 (7.8) AA 0 (0) 0 (0) a GATT4GATT7 genotype arbitrarily grouped with GATT7GATT7. Login to comment

PMID: 20384480 [PubMed] Rocchi L et al: "Escherichia coli-cloned CFTR loci relevant for human artificial chromosome therapy."

No. Sentence Comment

48 For construction of the intermediate construct CF1-Met, primers MetF and MetR (Table 1) were used for the V470M exchange by site-directed mutagenesis in a plasmid containing an intron 9 and exon 10 portion during construction of CGT21, and primers E10XcF and CF10NMR (Table 1) for the introduction of the silent XmaI variant and intronic NotI site for PAC ligation. Login to comment
93 PFGE separation, Table1.OligodeoxynucleotidesUsedinStudy PrimerSequence(50 -30 )LocationReferenceUsedfor: P77-BGGTCGAGCTTGACATTGTAGGpCYPAC2N(reverse)ThisworkPCR,endSequencing P86pCYPAC2NThisworkEndmapping T7TAATACGACTCACTATAGGGpCYPAC2NSchindelhauerandSchwarz, 2002;Laneretal.,2005 PCR R7CCTCTCCCTATAGTGAGTCGpCYPAC2N (reversecomplement ofT7) ThisworkPCR SP6ATTTAGGTGACACTATAGpCYPAC2NAnandetal.,1991LR-PCREnd sequencing ContYACTCTCGGTAGCCAAGTTGGTTYACleftarmThisworkEndmapping/ sequencingLR-PCR Primer2CCGGAATTCCGGACCGCCGCCG CAAGGAATGG YACrightarmThisworkEndmapping/ sequencingLR-PCR CF1-5RGTTCCAATTCTATAAGATTATCAGCFTR50 regionofCF1ThisworkLR-PCREnd mapping/sequencing 50 CFCCCATGGTGGAATAAAGTACCFTR50 regionof5AThisworkEndmapping/ sequencingLR-PCR CF-37FCGTGTTAGGCTGATTTTGCAGCCFTR50 regionThisworkLR-PCR CF-37RCGACCAGCACATAACAACTCAGCCFTR50 regionThisworkLR-PCR CF-18FGATGTCCTGCAACTGGCAGAGCFTR50 regionThisworkLR-PCR CF-18RCAGAGATCTACATGTGAGGGCCFTR50 regionThisworkLR-PCR CF-1FCTCAGAGAGTTGAAGATGGCGCFTR50 regionThisworkLR-PCR CF-1RGTGAGTGAACTCCAAGGGTGGCFTR50 regionThisworkLR-PCR A1RCGAGAGACCATGCAGAGGTCCFTRexon1Thiswork; Laneretal.,2005 RT-PCR CF3FCTTGGGTTAATCTCCTTGGACFTRintron2Thiswork; Zielenskietal.,1991 LR-PCR CF3RATTCACCAGATTTCGTAGTCCFTRintron3Thiswork; Zielenskietal.,1991 LR-PCR CFc3FGGGATAGAGAGCTGGCTTCCFTRexon3ThisworkRT-PCR Sequencing CF4FTCACATATGGTATGACCCTCCFTRintron3Thiswork; Zielenskietal.,1991 PCR CF4RTTGTACCAGCTCACTACCTACFTRintron4Thiswork; Zielenskietal.,1991 PCR CF7bFAGACCATGCTCAGATCTTCCATCFTRintron6Thiswork; Zielenskietal.,1991 LR-PCR CF7bRGCAAAGTTCATTAGAACTGATCCFTRintron7Thiswork; Zielenskietal.,1991 LR-PCR B3FAATGTAACAGCCTTCTGGGAGCFTRexon8Ramalhoetal.,2002RT-PCR Sequencing 1080 In9FCAAGTAGCAGGTGAAGCAAGTGCCFTRintron9ThisworkPCR Sequencing GFP1-ALGAACTTCAGGGTCAGCTTGCGT21,CFTR/EGFP fusionexon10 Laneretal.,2005RT-PCR Sequencing CF10FGCAGAGTACCTGAAACAGGACFTRintron9/exon10Thiswork;Zielenski etal.,1991 PCR CF10RCATTCACAGTAGCTTACCCACFTRintron10Thiswork;Zielenski etal.,1991 PCRLR-PCR MetFa GACTTCACTTCTAATGATGATTATGGGAGAACTGGCFTRintron10ThisworkPCR,V470M exchange MetRa CCAGTTCTCCCATAATCATCATTAGAAGTGAAGTCCFTRexon10ThisworkPCR,V470M exchange E10XcFa GGATTATGCCCGGGACCATTAAAGAAAATATCATCTTTGGsynthetic/CFTR,exon10ThisworkPCR,XmaIsite CF10NMRa CGGTGGTACGCGTGCGGCCGCCCTAACATTTACAGCAATAAsynthetic/CFTR,exon10ThisworkPCR,NotI/MluIsite C16DGTTGGCATGCTTTGATGACGCTTCCFTRexon10(reverse)Ramalhoetal.,2002PCRSequencing RT-PCR CFi10fusGTGACTGCAATTCTTTGATGCCFTRintron10ThisworkPCRSequencing CF11FCAACTGTGGTTAAAGCAATAGTGTCFTRintron10Thiswork;Zielenski etal.,1991 PCR CF11RGCACAGATTCTGAGTAACCATAATCFTRintron11Thiswork;Zielenski etal.,1991 PCRSequencing CF12FGTGAATCGATGTGGTGACCACFTRintron11Thiswork;Zielenski etal.,1991 PCR CF12RCTGGTTTAGCATGAGGCGGTCFTRintron12Thiswork;Zielenski etal.,1991 PCR CF14cRGTATGTGTTCCATGTAGTCACTGCCFTRexon14ThisworkLR-PCR CF14iFTTCTATGGATCATGAGCAGCCACCFTRintron14ThisworkLR-PCR CF17bFTTCAAAGAATGGCACCAGTGTCFTRintron17aThiswork;Zielenski etal.,1991 PCR CF17bRATAACCTATAGAATGCAGCACFTRintron17bThiswork;Zielenski etal.,1991 PCR CF19cFGCAAAATACACAGAAGGTGGAAATGCCCFTRexon19ThisworkLR-PCR CF21FAATGTTCACAAGGGACTCCACFTRintron20Thiswork;Zielenski etal.,1991 PCR CF21RCAAAAGTACCTGTTGCTCCACFTRintron21Thiswork;Zielenski etal.,1991 PCR CFaFCTAGGGTGATATTAACCAGGGCFTRpoly(A)regionThisworkPCR CFaRGAGGCTTGAAGACATTATGCTAGCFTRpoly(A)regionThisworkPCR aM2RGTTGCAGCGCTATGAGGCTTGAAGACATTATGCTAGsynthetic/CFTR,þ2kb(stop)ThisworkCGT21construction LR-PCR aB5Ra GTGTTGCAGCGCGCTTTCAGCTCTGCCGTCTGCCFTR30 region,syntheticThisworkLR-PCR,BssHIIsite CF6-4FCTCTGTGAAGGAGGTTCTAAGAACCFTRþ9.5kb(stop)ThisworkLR-PCREndsequencing CFþ23FTGTCTACTGAGCAGAGGTAGCCFTRþ23kb(stop)ThisworkLR-PCR CFþ23RGTAGCAGAGTCTAGAATTAGTCCCFTRþ23kb(stop)ThisworkLR-PCR 30 CFCTCTGTGATTCACACTGAAAGCFTRþ51kb(stop)ThisworkEndmapping/sequencing LR-PCR AcFGCACTCTTCCAGCCTTCCb-ActinThiswork;Laner etal.,2005 RT-PCR AcRAGAAAGGGTGTAACGCAACTAAGb-ActinThisworkRT-PCR a Modifiedprimers. Login to comment
158 Sequencing of the cloned exon 10, determined with primers In9F/P77-B, confirmed the right orientation and the presence of the corrected V470M polymorphism, and that the sequence in all three clones had no PCR-derived mutation. Login to comment

PMID: 22483971 [PubMed] Li H et al: "Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) in Chinese patients with congenital bilateral absence of vas deferens."

No. Sentence Comment

77 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1). Login to comment
76 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1). Login to comment

PMID: 22740931 [PubMed] Oh IH et al: "Association of CFTR gene polymorphisms with papillary thyroid cancer."

No. Sentence Comment

5 One promoter SNP (rs4148682) and one coding SNP (rs213950, Val470Met) in the CFTR gene were analyzed, using direct sequencing. Login to comment
50 Two SNPs (rs4148682, promoter; rs213950, missense, Val470Met) were selected. Login to comment
95 SNP Type Control PTC Model OR (95% CI) P-value ------------------ ------------------- n (%) n (%) rs4148682 Genotype T/T 93 (28.8) 27 (25.7) Co-dominant 1 1.26 (0.73-2.18) 0.70 -175 T/G 155 (48) 50 (47.6) Co-dominant 2 1.36 (0.73-2.54) 0.42 G/G 75 (23.2) 28 (26.7) Dominant 1.30 (0.78-2.16) 0.32 Recessive 1.18 (0.70-1.97) 0.54 Allele T 341 (52.8) 104 (49.5) 1 G 305 (47.2) 106 (50.5) 1.14 (0.84-1.56) 0.41 rs213950 Genotype G/G 110 (34.1) 31 (29.5) Co-dominant 1 1.23 (0.73-2.07) 0.64 Val470Met A/G 154 (47.7) 49 (46.7) Co-dominant 2 1.54 (0.82-2.89) 0.19 A/A 59 (18.3) 25 (23.8) Dominant 1.32 (0.81-2.14) 0.27 Recessive 1.36 (0.79-2.35) 0.27 Allele G 374 (83.9) 111 (52.9) 1 A 272 (16.1) 99 (47.1) 1.23 (0.90-1.68) 0.20 PTC, papillary thyroid cancer; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval. P-values were calculated from the logistic regression analyses adjusting for gender and age. Login to comment
105 SNP Type Unifocality Multifocality Model OR (95% CI) P-value --------------------- ------------------------ n (%) n (%) rs4148682 Genotype T/T 11 (16.9) 16 (44.4) Co-dominant 1 0.21 (0.08-0.60) 0.003 -175 T/G 36 (55.4) 11 (30.6) Co-dominant 2 0.34 (0.11-1.04) 0.06 G/G 18 (27.7) 9 (25.0) Dominant 0.26 (0.10-0.65) 0.004 Recessive 0.84 (0.33-2.15) 0.72 Allele G 72 (55.4) 29 (40.3) 1 T 58 (44.6) 43 (59.7) 1.92 (1.07-3.43) 0.028 rs213950 Genotype G/G 13 (20.0) 18 (50.0) Co-dominant 1 0.20 (0.07-0.56) 0.002 Val470Met A/G 35 (53.9) 10 (27.8) Co-dominant 2 0.34 (0.11-1.03) 0.06 A/A 17 (26.1) 8 (22.2) Dominant 0.25 (0.10-0.61) 0.002 Recessive 0.80 (0.30-2.10) 0.64 Allele A 69 (53.1) 26 (36.1) 1 G 61 (46.9) 46 (63.9) 2.00 (1.01-3.62) 0.022 PTC, papillary thyroid cancer; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval. P-values were calculated from the logistic regression analyses adjusting for gender and age. Bold numbers represent a statistically significant association. Table IV. Login to comment
107 SNP Type <1 cm (tumor size) ≥1 cm (tumor size) Model OR (95% CI) P-value ---------------------------------- ---------------------------------- n (%) n (%) rs4148682 Genotype T/T 15 (27.8) 12 (24.5) Co-dominant 1 1.05 (0.40-2.74) 0.84 -175 T/G 26 (48.1) 23 (46.9) Co-dominant 2 1.38 (0.46-4.10) 0.59 G/G 13 (24.1) 14 (28.6) Dominant 1.16 (0.47-2.83) 0.75 Recessive 1.34 (0.54-3.30) 0.52 Allele T 56 (51.9) 47 (48.0) 1 G 52 (48.1) 51 (52.0) 1.17 (0.68-2.02) 0.58 rs213950 Genotype G/G 18 (33.3) 13 (26.5) Co-dominant 1 1.34 (0.52-3.41) 0.54 Val470Met A/G 24 (44.4) 23 (46.9) Co-dominant 2 1.49 (0.51-4.40) 0.50 A/A 12 (22.2) 13 (26.5) Dominant 1.39 (0.59-3.31) 0.45 Recessive 1.26 (0.50-3.17) 0.63 Allele G 60 (55.6) 49 (50.0) 1 A 48 (44.4) 49 (50.0) 1.25 (0.72-2.16) 0.43 PTC, papillary thyroid cancer; SNP, single nucleotide polymorphism; OR, odds ratio; CI, The prognosis of thyroid cancer is generally good (2); however, it is crucial to identify patients at higher risk of recurrence in order to provide appropriate monitoring and treatment. Login to comment
112 Thus, the promoter SNP (rs4148682, -175T/G) and the missense SNP (rs213950, Val470Met) were associated with multifocality, bilateral location in the thyroid lobes and cervical lymph node metastasis of the PTC. Login to comment
115 SNP Type One lobe Both lobes Model OR (95% CI) P-value ----------------- ------------------- n (%) n (%) rs4148682 Genotype T/T 13 (20.0) 14 (38.9) Co-dominant 1 0.44 (0.16-1.20) 0.08 -175 T/G 33 (50.8) 15 (41.7) Co-dominant 2 0.32 (0.10-1.04) 0.07 G/G 19 (29.2) 7 (19.4) Dominant 0.39 (0.16-1.00) 0.049 Recessive 0.52 (0.19-1.44) 0.20 Allele G 71 (54.6) 29 (40.3) 1 T 59 (45.4) 43 (59.7) 1.78 (1.00-3.20) 0.05 rs213950 Genotype G/G 15 (23.1) 16 (44.4) Co-dominant 1 0.37 (0.14-1.00) 0.048 Val470Met A/G 32 (49.2) 13 (36.1) Co-dominant 2 0.35 (0.11-1.11) 0.08 A/A 18 (27.7) 7 (19.4) Dominant 0.36 (0.15-0.89) 0.026 Recessive 0.60 (0.21-1.67) 0.32 Allele A 68 (52.3) 27 (37.5) 1 G 62 (47.7) 45 (62.5) 1.83 (1.02-3.29) 0.044 PTC, papillary thyroid cancer; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval. P-values were calculated from the logistic regression analyses adjusting for gender and age. Bold numbers represent a statistically significant association. Table VII. Genotype and allele frequencies of SNPs of the CFTR gene in PTC patients by metastasis. Login to comment
116 SNP Type Cervical lymph Cervical lymph Model OR P-value node node (95% CI) metastasis (-) metastasis (+) ----------------------------- ----------------------------- n (%) n (%) rs4148682 Genotype T/T 23 (33.3) 3 (10.3) Co-dominant 1 4.27 (1.09-16.65) 0.05 -175 T/G 32 (46.4) 16 (55.2) Co-dominant 2 5.25 (1.21-22.84) 0.022 G/G 14 (20.3) 10 (34.5) Dominant 4.59 (1.24-17.00) 0.01 Recessive 1.88 (0.70-5.07) 0.22 Allele T 78 (56.5) 22 (37.9) 1 G 60 (43.5) 36 (62.1) 2.13 (1.14-3.99) 0.019 rs213950 Genotype G/G 25 (36.2) 5 (17.2) Co-dominant 1 2.36 (0.74-7.59) 0.18 Val470Met A/G 32 (46.4) 14 (48.3) Co-dominant 2 4.15 (1.13-15.21) 0.028 A/A 12 (17.4) 10 (34.5) Dominant 2.88 (0.96-8.62) 0.044 Recessive 2.41 (0.87-6.70) 0.09 Allele G 82 (59.4) 24 (41.4) 1 A 56 (40.6) 34 (58.6) 2.07 (1.11-3.87) 0.022 PTC, papillary thyroid cancer; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval. P-values were calculated from the logistic regression analyses adjusting for gender and age. Bold numbers represent a statistically significant association. Login to comment
138 SNP Type Extra-thyroidal Extra-thyroidal Model OR (95% CI) P-value invasion (-) invasion (+) --------------------------- --------------------------- n (%) n (%) rs4148682 Genotype T/T 12 (24.5) 15 (28.3) Co-dominant 1 0.91 (0.35-2.38) 0.77 -175 T/G 23 (46.9) 25 (47.2) Co-dominant 2 0.73 (0.25-2.15) 0.59 G/G 14 (28.6) 13 (24.5) Dominant 0.84 (0.34-2.05) 0.7 Recessive 0.77 (0.32-1.90) 0.58 Allele G 51 (52.0) 51 (48.1) 1 T 47 (48.0) 55 (51.9) 1.17 (0.68-2.03) 0.58 rs213950 Genotype G/G 14 (28.6) 17 (32.1) Co-dominant 1 0.83 (0.33-2.10) 0.68 Val470Met A/G 23 (46.9) 23 (43.4) Co-dominant 2 0.90 (0.31-2.62) 0.83 A/A 12 (24.5) 13 (24.5) Dominant 0.85 (0.36-2.01) 0.72 Recessive 1.01 (0.40-2.52) 0.99 Allele A 47 (48.0) 49 (46.2) 1 G 51 (52.0) 57 (53.8) 1.07 (0.62-1.86) 0.80 PTC, papillary thyroid cancer; SNP, single nucleotide polymorphism; OR: odds ratio; CI: However, the present study has certain limitations. Login to comment

PMID: 10812063 [PubMed] Wei L et al: "Suppressive interactions between mutations located in the two nucleotide binding domains of CFTR."

No. Sentence Comment

29 The di&#a1;erent amino acid alterations, V470M, G628R and S1235R, were introduced using the Transformer Site-Directed Mutagenesis kit (Clontech Laboratories, Inc., Palo Alto, CA, USA). Login to comment

PMID: 23907436 [PubMed] Lazrak A et al: "The silent codon change I507-ATC->ATT contributes to the severity of the DeltaF508 CFTR channel dysfunction."

No. Sentence Comment

111 In addition to the 3-nt deletion in èc;F508 CFTR and the T&#a1;C alteration in the I507-ATC èc;F508 CFTR (Fig. 1), we identified 2 G&#a1;A nonsynonymous codon alterations compared to the GenBank sequences (nt 2490; V470M and nt 4423; V1475M). Login to comment
112 This naturally occurring G&#a1;A (nt 2490) polymorphism results in a valine-to-methionine change (V470M; ref. 38) and is represented as b03;60% methionine (M) and 40% valine (V) in b0e;30,000 patient samples tested at Ambry Genetics. Login to comment

PMID: 25492507 [PubMed] Nakano E et al: "Targeted next-generation sequencing effectively analyzed the cystic fibrosis transmembrane conductance regulator gene in pancreatitis."

No. Sentence Comment

90 On average, 90.3 % of the coding region was successfully covered by C20 reads Table 2 Non-synonymous CFTR variants detected in this study Exon Non-synonymous variant Amino acid change dbSNP135 Genotype SIFT (score) PolyPhen-2 (score) Alcoholic CP (%) Idiopathic CP (%) Hereditary/ familial CP (%) 2 c.91C[T p.R31C rs1800073 CT D (0.012) PD (0.989) 0/46 (0) 3/121 (2.5) 0/26 (0) 2 c.92G[A p.R31H rs149353983 GA T (0.183) B (0.003) 0/46 (0) 1/121 (0.8) 0/26 (0) 4 c.374T[C p.I125T rs141723617 TC D (0.005) B (0.17) 0/46 (0) 2/121 (1.6) 1/26 (3.8) 10 c.1231A[G p.K411E - AG D (0.015) B (0.233) 0/46 (0) 1/121 (0.8) 0/26 (0) 11 c.1408G[A p.V470M rs213950 GA T (1) B (0) 21/46 (45.7) 65/121 (53.7) 11/26 (42.3) AA 5/46 (10.9) 19/121 (15.7) 1/26 (3.8) 12 c.1666A[G p.I556V rs75789129 AG T (0.536) B (0.334) 2/46 (4.3) 8/121 (6.6) 0/26 (0) GG 0/46 (0) 0/121 (0) 0/26 (0) 13 c.1753G[T p.E585X - GT - - 1/46 (2.2) 0/121 (0) 0/26 (0) 17 c.2869delC p.L957fs - - - 0/46 (0) 1/121 (0.8) 0/26 (0) 21 c.3468G[T p.L1156F rs139729994 GT T (0.163) PD (0.994) 2/46 (4.3) 10/121 (8.3) 2/26 (7.7) TT 1/46 (2.2) 0/121 (0) 0/26 (0) 25 c.4045G[A p.G1349S rs201686600 GA D (0) PD (1) 1/46 (2.2) 0/121 (0) 0/26 (0) 25 c.4056G[C p.Q1352H rs113857788 GC D (0) PD (1) 5/46 (10.9) 11/121 (9.1) 4/26 (15.4) CC 0/46 (0) 0/121 (0) 0/26 (0) 27 c.4357C[T p.R1453W rs4148725 CT D (0) PD (0.999) 3/46 (6.5) 6/121 (5.0) 1/26 (3.8) B benign, CP chronic pancreatitis, D damaging, PD probably damaging, T tolerated, SIFT Sorting Intolerant From Tolerant heterozygous form (Table 6). Login to comment
100 There were no significant difference for any other non-synonymous or synonymous variants detected in the exons Table 3 Comparison of the non-synonymous variant frequencies between the patients with CP and controls Amino acid change Genotype All CP (%) HGVD (%) P value (vs. HGVD) All CP Alcoholic CP Nonalcoholic CP Idiopathic CP Hereditary/ familial CP p.R31C CT 3/193 (1.6) 12/1102 (1.1) 0.48 [0.99 0.41 0.18 [0.99 p.R31H GA 1/193 (0.5) 0 - - - - - p.I125T TC 3/193 (1.6) 5/1102 (0.5) 0.11 [0.99 0.057 0.15 0.13 p.K411E AG 1/193 (0.5) 0 - - - - - p.V470M GA 97/193 (50.3) 573/1199 (47.8) 0.66 0.57 0.68 0.38 0.12 AA 25/193 (13.0) 185/1199 (15.4) p.I556V AG 10/193 (5.2) 78/1150 (6.8) 0.70 0.79 0.81 [0.99 0.45 GG 0/193 (0) 3/1150 (0.3) p.E585X GT 1/193 (0.5) 0 - - - - - p.L957fs 1/193 (0.5) 0 - - - - - p.L1156F GT 14/193 (7.3) 45/1136 (4.0) 0.04 0.06 0.07 0.11 0.30 TT 1/193 (0.5) 1/1136 (0.1) p.G1349S GA 1/193 (0.5) 4/1094 (0.4) 0.56 0.19 [0.99 [0.99 [0.99 p.Q1352H GC 20/193 (10.4) 57/1153 (4.9) 0.009 0.12 0.037 0.17 0.062 CC 0/193 (0) 1/1153 (0.1) p.R1453W CT 10/193 (5.2) 42/1144 (3.7) 0.32 0.25 0.49 0.45 [0.99 CP chronic pancreatitis, HGVB Human Genetic Variation Database P values were determined versus HGVD by the Fisher`s exact test Table 4 Synonymous variants in the exons of the CFTR gene detected in this study Exon Synonymous variant Amino acid change dbSNP135 Genotype Alcoholic CP (%) Idiopathic CP (%) Hereditary/ familial CP (%) 4 c.372C[T p.G124= - CT 0/46 (0) 1/121 (0.8) 0/26 (0) 13 c.1731C[T p.Y577= rs55928397 CT 0/46 (0) 1/121 (0.8) 0/26 (0) 15 c.2562T[G p.T854= rs1042077 TG 20/46 (43.5) 69/121 (57.0) 12/26 (46.2) GG 6/46 (13.0) 18/121 (14.9) 0/26 (0) 23 c.3723C[A p.G1241= rs185065886 CA 1/46 (2.2) 0/121 (0) 0/26 (0) 25 c.3975A[G p.R1325= - AG 0/46 (0) 1/121 (0.8) 0/26 (0) 27 c.4254G[A p.E1418= - GA 0/46 (0) 1/121 (0.8) 0/26 (0) 27 c.4389G[A p.Q1463= rs1800136 GA 1/46 (2.2) 3/121 (2.5) 0/26 (0) CP chronic pancreatitis between all patients with CP and controls (Tables 3, 5). Login to comment
151 Sequence capture eliminates the necessity of setting up hundreds of PCR, instead allowing for parallel Table 8 Total CFTR sequencing results of patients with SPINK1, PRSS1, CTRC, or CPA1 mutations Case# Etiology CFTR variantsa c.1210-34TG(9_13) c.1210-12T(5_9) SPINK1 PRSS1 CTRC CPA1 B1 Familial p.Q1352H/- TG11/TG12, 7T/7T p.N34S/p.N34S B2 Idiopathic - TG12/TG12, 7T/7T p.N34S/p.N34S B3 Idiopathic - TG11/TG12, 7T/7T p.N34S/p.N34S B4 Idiopathic p.L1156F/-, p.Q1352H/- TG11/TG11, 7T/7T p.N34S/- B5 Idiopathic p.Q1352H/- TG11/TG12, 7T/7T p.N34S/- B6 Idiopathic p.Q1352H/- TG11/TG12, 7T/7T p.N34S/- B7 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B8 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B9 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B10 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B11 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B12 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B13 Idiopathic - TG11/TG12, 7T/7T p.N34S/- B14 Alcoholic - TG12/TG13, 5T/7T p.N34S/- B15 Idiopathic - TG11/TG12, 7T/7T p.N34S/IVS3?2T[C B16 Idiopathic p.R1453W/- TG11/TG11, 7T/7T p.N34S/IVS3?2T[C B17 Idiopathic - TG11/TG12, 7T/7T IVS3?2T[C/IVS3?2T[C B18 Idiopathic - TG11/TG12, 7T/7T IVS3?2T[C/IVS3?2T[C B19 Hereditary p.I125T/-, p.L1156F/- TG11/TG12, 5T/7T IVS3?2T[C/- B20 Familial p.L1156F/- TG11/TG12, 7T/7T IVS3?2T[C/- B21 Idiopathic - TG11/TG12, 7T/7T IVS3?2T[C/- B22 Alcoholic p.Q1352H/- TG11/TG12, 7T/7T IVS3?2T[C/- B23 Alcoholic - TG11/TG12, 7T/7T IVS3?2T[C/- B24 Idiopathic - TG11/TG12, 7T/7T p.P45S/- B25 Idiopathic - TG12/TG12, 7T/7T IVS3?2T[C/- p.R122H/- B26 Hereditary TG11/TG12, 7T/7T p.R122H/- B27 Idiopathic p.I556V/- TG11/TG12, 7T/7T p.N29I/- B28 Idiopathic p.I125T/-, p.L1156F/- TG11/TG12, 7T/7T p.R29Q/- B29 Idiopathic - TG11/TG12, 7T/7T p.T368_Y369ins20/- Nine patients had the non-synonymous CFTR variants, which are probably damaging based on the SIFT or the PolyPhen-2 prediction The p.I556V variant appeared to be benign based on the SIFT or the PolyPhen-2 prediction Case B28 is the same as A5 in Table 6 a We excluded the p.V470M variant from the list because of its similar frequencies in patients and controls enrichment of target regions in a single experiment. Login to comment