ABCMdb

ABCC7 p.Trp57*

None has been submitted yet.

Publications

PMID: 12000363 [PubMed] Visich A et al: "Complete screening of the CFTR gene in Argentine cystic fibrosis patients."

No. Sentence Comment

56 Frequency of cystic fibrosis transmembrane regulator mutations in the Argentine population: 440 chromosomes analysed Mutation Localization Chromosome Number Percentage DF508 Exon 10 258 58.64 G542X Exon 11 18 4.10 W1282X Exon 20 12 2.73 N1303K Exon 21 12 2.73 R334W Exon 7 5 1.14 1717-1G»A Intron 10 5 1.14 3849π10KbC»T Intron 19 4 0.91 1811π1.6KbA»G Intron 11 4 0.91 IVS8-5T Intron 8 4 0.91 G85E Exon 3 3 0.68 621π1G»T Intron 4 3 0.68 2789π5G»A Intron 14b 3 0.68 DI507 Exon 10 3 0.68 2184delA Exon 13 2 0.45 2566insT Exon 13 2 0.45 2686insT Exon 14a 2 0.45 3659delC Exon 19 2 0.45 R1162X Exon 19 2 0.45 4016insT Exon 21 2 0.45 2789π2insA Intron 14b 2 0.45 L6V Exon 1 1 0.23 297π2A»G Intron 2 1 0.23 W57X Exon 3 1 0.23 R75Q Exon 3 1 0.23 Q220X Exon 6a 1 0.23 Y362X Exon 7 1 0.23 D426C Exon 9 1 0.23 1460delAT Exon 9 1 0.23 1353insT Exon 9 1 0.23 1782delA Exon 11 1 0.23 R553X Exon 11 1 0.23 S549R Exon 11 1 0.23 1898π3A»G Intron 12 1 0.23 2594delGT Exon 13 1 0.23 2183AA»G Exon 13 1 0.23 I1027T Exon 17a 1 0.23 R1066C Exon 17b 1 0.23 G1061R Exon 17b 1 0.23 4005-1G»A Intron 20 1 0.23 Total 367 83.45 209 nificant differences were observed among the compared populations (Table2). Login to comment

PMID: 21811577 [PubMed] Sorio C et al: "Defective CFTR expression and function are detectable in blood monocytes: development of a new blood test for cystic fibrosis."

No. Sentence Comment

202 Case Gender Age at diagnosis (years) CFTR genotype* Age (years) Sweat Cl- mEq/L** FEV1 % mean values 2009 Pa PI NPD results*** CF-index 1 F 0 3132delTG 1497delGG 34 129 75 yes yes nd 222,10 2 F 0 R1162X R1162X 43 144 52 yes yes nd 229,65 3 M 0 R1162X R1162X 10 102 59 no yes 1,02 210,18 4 M 0 R1162X R1162X 25 115 81 no yes 1,07 267,11 5 M 7 G542X 711+5 G.A 24 105 59 yes yes nd 25,84 6 M 1 CFTRdele1 G542X 36 107 22 yes yes nd 2113,92 7 M 0 G542X G542X 16 110 71 yes yes 0,97 280,20 8 F 1 Q552X CFTRdele17a-18 35 99 72 yes yes 2,08 2219,81 9 M 16 R1162X 3849+10 Kb C.T 42 74 43 yes no 1,02 271,47 10 M 0 R1162X R1162X 32 105 45 yes yes 1,43 2114,67 11 M 1 F508del F508del 16 86 71 no yes nd 260,04 12 F 0 F508del F508del 16 88 118 no yes nd 248,20 13 M 0 F508del F508del 33 118 51 yes yes nd 265,49 14 M 7 F508del F508del 37 89 37 yes yes nd 2359,82 15 F 0 F508del F508del 27 118 71 yes yes nd 267,26 16 F 8 1717-1 G.A F508del 38 140 74 yes yes nd 2136,80 17 F 0 R1158X F508del 32 95 60 yes yes 1,77 228,31 18 M 7 G542X F508del 39 110 46 yes yes nd 247,52 19 M 0 Q39X F508del 17 101 79 no yes 1,11 264,20 20 F 1 R1162X F508del 41 188 60 no yes 0,94 296,73 21 M 13 3849+10 Kb C.T F508del 24 76 78 yes no 4,67 26,33 22 M 0 W1282X 621+1G.T 33 119 77 yes yes 1,27 242,74 23 F 4 R553X 2789+5 G.A 31 92 44 yes no 7,4 260,94 24 F 11 F508del R553X 39 116 55 yes yes nd 2113,67 25 M 12 F508del 3849+10 Kb C.T 27 51 71 yes no 1,12 298,84 26 F 0 F508del G542X 19 109 109 yes yes nd 2173,24 27 F 0 F508del R1162X 32 94 86 yes yes 1,34 270,16 28 F 0 F508del W57X (TAG) 27 99 78 yes yes 1,21 269,33 29 M 0 F508del Q552X 24 94 41 yes yes 1,50 272,75 30 M 20 F508del 3849+10 Kb C.T 43 58 60 no no 1,13 2112,56 31 M 0 F508del R1162X 12 99 65 no yes 2,14 280,92 32 M 4 F508del 3849+10 Kb C.T 17 60 100 no no nd 2121,31 33 F 1 F508del 1717-1 G.A 26 105 73 yes yes 2,05 255,66 34 F 11 F508del 3849+10 Kb C.T 40 85 59 yes no nd 2152,23 35 F 4 F508del 1717-1 G.A 44 130 97 yes yes nd 2116,56 36 M 13 F508del 3849+10 Kb C.T 43 70 65 yes no CF 265,10 37 F 19 F508del unknown 29 95 100 no no nd 240,53 38 M 6 F508del unknown 15 92 87 yes no nd 270,17 39 F 0 G542X N1303K 34 108 97 yes yes nd 296,14 40 M 50 G1249R IVS8 T5TG12 50 61 74 no no nd 2199,15 41 F 10 2183 AA.G IVS8 T5TG15/T7TG10 45 79 29 yes no 1,9 286,27 42 F 1 G85E unknown 43 120 107 yes no nd 249,21 43 F 0 3272-26 A.G I507del 21 113 88 no no nd 236,79 44 M 8 F508del D1152H 10 77 107 no no nd 210,85 *Cystic Fibrosis mutation database reference: http://www3.genet.sickkids.on.ca/cftr/app. Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

PMID: 21909392 [PubMed] Roth EK et al: "The K+ channel opener 1-EBIO potentiates residual function of mutant CFTR in rectal biopsies from cystic fibrosis patients."

No. Sentence Comment

46 CFabsent CFresidual CFTR genotype Number of individuals CFTR genotype Number of individuals F508del/F508del 10 F508del/Y161C 1 F508del/W57X 1 F508del/V232D 1 F508del/G85E 3 F508del/R334W 2 F508del/120del23 1 F508del/T338I 1 F508del/182delT 1 F508del/I1234V 1 F508del/G542X 1 F508del/3272-26 A.G 1 F508del/A561E 1 F508del/3849+10 kb C.T 1 F508del/Y1092X 1 F508del/4005 +5727 A.G 1 F508del/N1303K 1 F508del/G576A 1 F508del/1525-1 G.A 2 N1303K/R334W 1 F508del/Q39X 1 F1052V/M1137R 1 F508del/Q552X 1 1898+3 A.G/ 1898+3 A.G 1 G85E/G85E 1 R334W/3199del6 1 Q552X/R1162X 1 R334W/X 1 A561E/A561E 2 dele2,3/X 1 R764X/1717-1 G.A 1 R1158X/2183AA.G 1 R1158X/R560T 1 doi:10.1371/journal.pone.0024445.t001 luminal and basolateral surfaces of the epithelium were perfused continuously with a solution of the following composition (mmol/ L): NaCl 145, KH2PO4 0.4, K2HPO4 1.6, D-glucose 5, MgCl2 1, Ca-gluconate 1.3, pH 7.4, at 37uC. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb. Login to comment

PMID: 7521710 [PubMed] Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."

No. Sentence Comment

120 Exon 1: S4X (24), 186-13C-G (F£rec et al., pers. comm.); Exon 2: G27X (Shacldeton and Harris, pers. comm.), Q30X (Chilldn aal., pers. comm.), R31L (Zielenski et al., pers. comm.), Q39X (25); Exon 3: 300delA (Malone et al., pers. comm.), W57G (Ferrari et al., pers. comm.), W57X (26), E60X (Malone et al., pers. comm.), R74W (Claustres et al., pers. comm.), R75Q (27), G85E (28), 394delTT (Claustres et al., pers. comm.), L88X (Maceketal., pers. comm.), L88S (Malone et al., pers. comm.), 405 + 1G-A (Dork and Tummler, pers. comm.); Exon 4: E92K (Chillon et al., pers. comm.), E92X (D6rk a al., pers. comm.), P99L (Schwartz and Holmberg, pers. comm.), 441delA (Zielenski et al., pers. comm.), 444delA (29), 457TAT-C- (F£rec et al., pers. comm., (21), Dl 10H (14), Rl 17C (D6rk et al., pers. comm.), Rl 17H (14), A120T (Chillon et al., pers. comm.), 541delC (30), 556delA (28), I148T (Rininsland et al., pers. comm.), Q151X (Shacldeton et al., pers. comm.), 621 + 1C-T (28), 622-2A-C (31); Exon5:G178R (28), 681delC (Zielenski a al., pers. comm.), 711 + 1G-T (28); Exon 6a: H199Y (Dork and Tummler, pers. comm.), H199Q (Dean etal., pers. comm.), L206W (Claustres et al., pers. comm.), Q220X (Shacldeton and Harris, pers. comm., Schwartz and Holmberg, pers. comm.), 852del22 (32); Exon 6b: 977insA (33); Exon7:F311L(34). Login to comment

PMID: 7683952 [PubMed] Audrezet MP et al: "Identification of 12 novel mutations in the CFTR gene."

No. Sentence Comment

68 W57X In exon 3 the nucleotide change at position 302 (G - A) leads to a change at codon 57 (TGG) encoding a tryptophan is changed to a TGA stop codon. Login to comment
91 The 3898 ins C in exon 20 is a frameshift mutation; the W57X, K716X, Q1238X and Q1313X are nonsense mutations. Login to comment

PMID: 16963320 [PubMed] Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."

No. Sentence Comment

42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
46 of chromosomes analysed p.F508del p.G542X p.W1282X p.N1303K p.R1162X p.L6VÌe; p.W57X p.R75X p.G85E p.R117H p.H199Y p.V201M p.L206W p.Q220X p.V232D p.Y275XÌe; p.R334W p.R347P p.Y362XÌe; p.I506T Argentina 98 61 440 258 18 12 12 2 1 1 3 1 5 1 310 181 20 7 5 5 7 0 5 0 222 135 15 7 5 1 26 14 2 1 1 150 88 6 6 1 2 3 Subtotal and frequency (%) 1246 100 737 59.15 61 4.90 27 2.17 28 2.25 9 0.72 1 0.08 1 0.08 13 1.04 1 0.08 13 1.04 1 0.08 Brazil 468 221 26 11 74 38 2 1 320 155 28 3 8 8 4 1 2 1 1 8 122 62 120 38 10 3 148 38 4 0 0 48 15 154 75 5 1 0 2 0 386 154 24 6 10 17 9 0 10 1 18 4 0 0 2 0 0 0 0 Subtotal and frequency (%) 1858 100 800 43.06 99 5.33 11 0.59 34 1.83 25 1.35 13 0.70 1 0.05 2 0.11 1 0.05 1 0.05 20 1.07 1 0.05 Chile 72 21 36 11 3 0 44 22 4 3 1 1 100 45 7 5 0 2 0 2 0 Subtotal and frequency (%) 252 100 99 41.28 14 5.55 8 3.17 3 1.19 3 1.19 Colombia 184 77 7 2 1 2 1 34 13 2 1 1 Subtotal and frequency (%) 218 100 90 41.28 9 4.13 3 1.38 2 0.92 2 0.92 1 0.46 Costa Rica Frequency (%) 48 100 11 22.91 12 25.00 0 0 0 0 0 Cuba Frequency (%) 144 100 49 34.03 Ecuador 32 11 1 50 16 2 2 20 5 0 0 0 Subtotal and frequency (%) 102 100 32 31.37 2 1.96 1 0.98 2 1.96 Mexico 194 79 12 4 3 1 1 1 2 80 36 4 1 Subtotal and frequency (%) 274 100 115 41.97 16 5.84 5 1.82 3 1.09 1 0.36 1 0.36 1 0.36 2 0.73 Uruguay Frequency (%) 76 100 43 56.58 6 7.89 2 2.63 3 3.95 3 3.95 2 2.63 Venezuela 54 16 2 82 41 Subtotal and frequency (%) 136 100 57 41.91 2 1.47 Total 4354 2033 221 49 72 42 1 1 3 32 1 1 1 2 1 1 1 39 1 1 2 Frequency (%) 100 46.69 5.08 1.13 1.65 0.96 0.02 0.02 0.07 0.73 0.02 0.02 0.02 0.05 0.02 0.02 0.02 0.90 0.02 0.02 0.05 The five most frequent mutations are shown on the left-hand side, followed by the rest of the mutations in 5'-3' and exon-intron order. Login to comment
98 As an example, in the case of Argentina and Uruguay, the p.F508del mutation shows the highest frequencies (59% and Table 5 Mutations with frequencies less than 0.1% Panel A Mutation Number of chromosomes % Country p.R75X 3 0.07 Mexico c.W1089X 3 0.07 Argentina, Brazil c.406-1GNA 3 0.07 Mexico c.1898+1GNA 3 0.07 Argentina, Brazil c.2686_2687insTÌe; 3 0.07 Argentina, Brazil p.L206W 2 0.05 Brazil p.I506T 2 0.05 Mexico p.S589I 2 0.05 Argentina c.711+1GNT 2 0.05 Argentina c.935delA 2 0.05 Mexico c.2055_2063del 2 0.05 Mexico c.2347delG 2 0.05 Brazil c.2566_2567insTÌe; 2 0.05 Argentina c.2789+2_2789+3insA 2 0.05 Argentina c.3199_3204del 2 0.05 Mexico c.3272-26ANG 2 0.05 Argentina c.4016_4017insT 2 0.05 Argentina Panel B Mutation N % each Country p.L6VÌe;, p.W57X, p.Q220X, p.Y362XÌe;, p.I1027T, p.G1061R, p.R1283M, c.297-2ANG, c.1353_1354insTÌe;, c.1460_1461delATÌe;, c.1782delA, c.1898+3ANG, c.2184delA, c.2594_2595delGTÌe;, c.2869_2870insG, c.4005Ìe;1GNA, c.4005-1GNA# 17 0.02 Argentina p.R117H, p.H199Y, p.G551S, p.L558S, p.P750L, p.V754M, p.W1069X#, p.W1098CÌe;, p.W1204X, c.297-1GNAÌe;, c.846delTÌe;, c.1078delT, c.1716GNA, c.1924_1930del, c.4160_4161insGGGGÌe; 15 0.02 Mexico p.V201M, p.V232D, p.Y275XÌe;, p.R347P, p.R851L, p.Q1238X, c.3171delC, c.3617_3618delGAÌe;# 8 0.02 Brazil p.A559T, p.H609RÌe;, c.1215delG, c.1323_1324insAÌe;, c.2185_2186insC, c.3500-2ANGÌe;, c.3849+1GNA, 7 0.02 Colombia c.-834GNT 1 0.02 Uruguay The upper part (Panel A) shows the mutations found in more than one patient, whereas the lower part (Panel B) of the table shows all the mutations that are present only once in each country. Login to comment